Mutagenetix > Incidental Mutations

Incidental Mutation 'R8029:Prex1'

617805

Institutional Source

Beutler Lab

Gene Symbol

Prex1

Ensembl Gene

ENSMUSG00000039621

Gene Name

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1

Synonyms

P-REX1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.244) question?

Stock #

R8029 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

166566342-166713832 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 166575603 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 1361 (Q1361H)

Ref Sequence

ENSEMBL: ENSMUSP00000037180 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080] [ENSMUST00000109246]

Predicted Effect

probably benign
Transcript: ENSMUST00000036719
AA Change: Q1361H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: Q1361H

Domain	Start	End	E-Value	Type
low complexity region	3	27	N/A	INTRINSIC
RhoGEF	48	234	3.16e-52	SMART
PH	267	389	1.02e-10	SMART
DEP	418	491	6.86e-27	SMART
DEP	519	592	3.06e-24	SMART
PDZ	628	701	4.55e-1	SMART
PDZ	712	783	5.66e-1	SMART
low complexity region	800	811	N/A	INTRINSIC
low complexity region	814	825	N/A	INTRINSIC
low complexity region	1109	1127	N/A	INTRINSIC
low complexity region	1545	1555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099080
AA Change: Q1191H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: Q1191H

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	5	64	3.8e-18	PFAM
PH	97	219	1.02e-10	SMART
DEP	248	321	6.86e-27	SMART
DEP	349	422	3.06e-24	SMART
PDZ	458	531	4.55e-1	SMART
PDZ	542	613	5.66e-1	SMART
low complexity region	630	641	N/A	INTRINSIC
low complexity region	644	655	N/A	INTRINSIC
low complexity region	939	957	N/A	INTRINSIC
low complexity region	1375	1385	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109246
AA Change: Q173H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000104869
Gene: ENSMUSG00000039621
AA Change: Q173H

Domain	Start	End	E-Value	Type
low complexity region	357	367	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,377	H543R	possibly damaging	Het
Acvr1c	A	G	2: 58,296,117	I118T	possibly damaging	Het
Alpk1	T	C	3: 127,729,285	D36G	possibly damaging	Het
Aox2	G	A	1: 58,343,668	V1036I	probably benign	Het
Arhgef1	T	C	7: 24,919,738	L468P	probably damaging	Het
Armc2	A	T	10: 41,927,000	L559Q	probably damaging	Het
Asb3	A	T	11: 31,101,180	R506*	probably null	Het
Asna1	T	C	8: 85,019,827	M131V	probably benign	Het
Aspm	A	G	1: 139,471,632	H1045R	probably benign	Het
Cacna1g	G	T	11: 94,409,738	R2099S	probably benign	Het
Cd177	C	T	7: 24,756,169	W309*	probably null	Het
Cd34	A	C	1: 194,958,552	M242L	probably benign	Het
Cdh24	T	A	14: 54,639,399	N49I	probably damaging	Het
Ces2b	A	G	8: 104,834,850	N192S	probably damaging	Het
Chsy3	A	G	18: 59,179,447	I331V	possibly damaging	Het
Disp1	A	G	1: 183,089,288	S523P	probably damaging	Het
Dlgap5	T	C	14: 47,416,440	H44R	probably benign	Het
Dnajc30	G	T	5: 135,064,332	A28S	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Exd1	A	T	2: 119,528,723	H226Q	probably damaging	Het
Gata6	T	A	18: 11,054,944	V291E	possibly damaging	Het
Gfi1b	A	T	2: 28,613,675		probably null	Het
Grk3	T	A	5: 112,961,642	I150L	probably benign	Het
Gstcd	C	T	3: 133,082,107	V277M	probably damaging	Het
Idua	T	C	5: 108,669,412	F17S	probably benign	Het
Ighg1	T	C	12: 113,329,145	K268R		Het
Lama1	G	T	17: 67,817,594	R2883M		Het
Lpar3	T	C	3: 146,240,963	M132T	probably benign	Het
Macf1	T	C	4: 123,444,892	T4351A	possibly damaging	Het
March6	A	G	15: 31,496,002		probably null	Het
Mbtps1	C	A	8: 119,547,805		probably benign	Het
Mctp1	T	C	13: 77,029,886	Y931H	probably damaging	Het
Mug2	A	G	6: 122,081,545		probably null	Het
Myh1	G	T	11: 67,211,240		probably null	Het
Mylk2	T	C	2: 152,920,299	S497P	probably damaging	Het
Nectin4	A	G	1: 171,386,687	D470G	probably benign	Het
Nop2	C	T	6: 125,144,420	P722S	possibly damaging	Het
Nphp1	T	C	2: 127,741,116	T626A	probably benign	Het
Nudt9	C	T	5: 104,050,611		probably benign	Het
Olfr1145	A	G	2: 87,810,032	T71A	probably benign	Het
Olfr18	A	G	9: 20,314,347	F191S	possibly damaging	Het
Olfr512	T	A	7: 108,713,830	F159Y	possibly damaging	Het
Olfr835	T	C	9: 19,035,794	S224P	probably damaging	Het
Oplah	T	C	15: 76,305,696	Y143C	probably benign	Het
Osbpl1a	T	G	18: 12,914,521	E125D	probably benign	Het
P2ry1	C	A	3: 61,003,522	N27K	possibly damaging	Het
Palld	A	T	8: 61,877,312	I177N	probably damaging	Het
Plcl1	A	T	1: 55,696,078	I193L	probably benign	Het
Polr1a	T	A	6: 71,912,956	L53*	probably null	Het
Ppp1r9a	A	G	6: 5,057,518	E531G	possibly damaging	Het
Ptprc	T	C	1: 138,078,459	E795G	probably damaging	Het
Rars	C	T	11: 35,821,165	V295I	probably damaging	Het
Rnaseh2b	T	C	14: 62,353,548	V116A	possibly damaging	Het
Rnf43	T	A	11: 87,731,894	L480H	probably benign	Het
Rttn	A	G	18: 89,090,474	T1601A	not run	Het
Setd1a	C	G	7: 127,786,214	Q698E	probably benign	Het
Sh3gl3	T	C	7: 82,270,883	Y100H	probably benign	Het
Sis	T	C	3: 72,921,142	Y1200C	probably damaging	Het
Snx13	A	C	12: 35,119,886	H610P	probably damaging	Het
Spdl1	T	C	11: 34,822,592	R217G	probably benign	Het
Spop	G	A	11: 95,474,367	E113K	probably benign	Het
Sult2a3	G	A	7: 14,121,628	P101L	probably damaging	Het
Tbl1xr1	C	T	3: 22,200,436	H348Y	probably damaging	Het
Tmie	T	C	9: 110,867,487	T109A	possibly damaging	Het
Ttc12	A	G	9: 49,470,251	V140A	possibly damaging	Het
Ube2m	A	G	7: 13,036,597	L58P	probably damaging	Het
Urb1	A	G	16: 90,779,152	S839P	possibly damaging	Het
Vmn2r117	T	A	17: 23,477,770	D221V	probably benign	Het
Vps41	C	T	13: 18,823,785	Q263*	probably null	Het
Zfand3	A	T	17: 30,135,433	T75S	probably benign	Het
Zscan26	A	G	13: 21,445,350	C202R	probably damaging	Het

Other mutations in Prex1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Prex1	APN	2	166638401	missense	probably damaging	1.00
IGL00309:Prex1	APN	2	166609823	missense	probably damaging	0.99
IGL00953:Prex1	APN	2	166638409	missense	probably damaging	1.00
IGL00961:Prex1	APN	2	166585736	missense	probably damaging	0.98
IGL01300:Prex1	APN	2	166638407	missense	possibly damaging	0.46
IGL01318:Prex1	APN	2	166569340	splice site	probably benign
IGL01753:Prex1	APN	2	166602882	missense	probably benign	0.11
IGL01819:Prex1	APN	2	166621245	missense	probably damaging	1.00
IGL02058:Prex1	APN	2	166585183	missense	probably benign	0.00
IGL02251:Prex1	APN	2	166577886	missense	probably damaging	0.99
IGL02326:Prex1	APN	2	166621185	missense	probably benign	0.35
IGL02366:Prex1	APN	2	166580427	missense	probably damaging	1.00
IGL02414:Prex1	APN	2	166609828	missense	probably damaging	1.00
IGL02660:Prex1	APN	2	166593867	missense	probably damaging	0.97
IGL02666:Prex1	APN	2	166572989	missense	probably benign	0.00
IGL02874:Prex1	APN	2	166585047	missense	probably damaging	1.00
IGL02935:Prex1	APN	2	166570345	missense	probably damaging	1.00
IGL03179:Prex1	APN	2	166585194	missense	probably benign	0.31
R0207:Prex1	UTSW	2	166585898	missense	possibly damaging	0.92
R0415:Prex1	UTSW	2	166586699	unclassified	probably benign
R0420:Prex1	UTSW	2	166589571	missense	probably benign	0.13
R0449:Prex1	UTSW	2	166569377	missense	probably benign	0.16
R0458:Prex1	UTSW	2	166585823	missense	probably damaging	0.99
R0927:Prex1	UTSW	2	166586537	missense	probably benign	0.01
R1299:Prex1	UTSW	2	166585907	missense	possibly damaging	0.62
R1414:Prex1	UTSW	2	166593861	missense	probably damaging	1.00
R1440:Prex1	UTSW	2	166580463	missense	probably damaging	0.98
R1506:Prex1	UTSW	2	166587081	missense	probably damaging	1.00
R1725:Prex1	UTSW	2	166601736	missense	probably damaging	1.00
R1831:Prex1	UTSW	2	166585101	missense	probably damaging	1.00
R1883:Prex1	UTSW	2	166583272	missense	probably benign	0.20
R1896:Prex1	UTSW	2	166586654	missense	probably benign	0.01
R2022:Prex1	UTSW	2	166575614	missense	possibly damaging	0.80
R2091:Prex1	UTSW	2	166569365	missense	possibly damaging	0.95
R2258:Prex1	UTSW	2	166587157	missense	probably benign	0.00
R2263:Prex1	UTSW	2	166589068	splice site	probably benign
R2276:Prex1	UTSW	2	166577955	missense	probably benign	0.34
R2279:Prex1	UTSW	2	166577955	missense	probably benign	0.34
R2680:Prex1	UTSW	2	166601772	missense	possibly damaging	0.92
R3024:Prex1	UTSW	2	166589036	missense	probably benign	0.04
R3421:Prex1	UTSW	2	166617854	missense	probably damaging	1.00
R3614:Prex1	UTSW	2	166609781	missense	probably damaging	1.00
R4244:Prex1	UTSW	2	166570336	missense	probably damaging	1.00
R4605:Prex1	UTSW	2	166713544	missense	probably benign	0.45
R4685:Prex1	UTSW	2	166638332	missense	probably damaging	0.97
R4787:Prex1	UTSW	2	166638340	missense	probably benign	0.01
R4796:Prex1	UTSW	2	166592291	missense	probably damaging	1.00
R4825:Prex1	UTSW	2	166585857	nonsense	probably null
R4955:Prex1	UTSW	2	166573223	missense	probably damaging	0.99
R5046:Prex1	UTSW	2	166572963	missense	probably benign	0.00
R5095:Prex1	UTSW	2	166581921	missense	probably damaging	1.00
R5408:Prex1	UTSW	2	166575653	small insertion	probably benign
R5462:Prex1	UTSW	2	166644808	missense	probably benign	0.02
R5535:Prex1	UTSW	2	166580273	missense	possibly damaging	0.80
R5777:Prex1	UTSW	2	166586659	missense	probably damaging	1.00
R5813:Prex1	UTSW	2	166583207	missense	probably benign
R5860:Prex1	UTSW	2	166644684	intron	probably benign
R5984:Prex1	UTSW	2	166585744	missense	probably damaging	1.00
R6009:Prex1	UTSW	2	166581984	missense	probably damaging	1.00
R6174:Prex1	UTSW	2	166572963	missense	probably benign	0.00
R6345:Prex1	UTSW	2	166572960	missense	probably null	0.81
R6897:Prex1	UTSW	2	166581993	missense	probably damaging	0.99
R6935:Prex1	UTSW	2	166599655	missense	probably damaging	1.00
R7025:Prex1	UTSW	2	166613187	small insertion	probably benign
R7037:Prex1	UTSW	2	166587180	missense	probably benign	0.05
R7076:Prex1	UTSW	2	166633382	missense	probably damaging	0.99
R7181:Prex1	UTSW	2	166570371	missense	probably damaging	1.00
R7361:Prex1	UTSW	2	166713570	missense	probably benign	0.04
R7381:Prex1	UTSW	2	166587127	missense	probably damaging	1.00
R7721:Prex1	UTSW	2	166577890	nonsense	probably null
R7763:Prex1	UTSW	2	166713709	missense	unknown
R7809:Prex1	UTSW	2	166573244	missense	possibly damaging	0.91
R7915:Prex1	UTSW	2	166621192	missense	probably damaging	1.00
R7971:Prex1	UTSW	2	166581939	missense	probably damaging	1.00
R7998:Prex1	UTSW	2	166587045	critical splice donor site	probably null
R8193:Prex1	UTSW	2	166593860	missense	possibly damaging	0.60
R8352:Prex1	UTSW	2	166589573	missense	probably benign	0.05
R8452:Prex1	UTSW	2	166589573	missense	probably benign	0.05
R8928:Prex1	UTSW	2	166585075	missense	probably damaging	0.97
X0065:Prex1	UTSW	2	166586625	missense	probably benign
Z1176:Prex1	UTSW	2	166572970	nonsense	probably null
Z1177:Prex1	UTSW	2	166592228	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGGACTTTTGTTCATCCACGAAC -3'
(R):5'- TTCAGAGTTCTCCACAGGCC -3'

Sequencing Primer
(F):5'- TTTTGTTCATCCACGAACTCCAAAAC -3'
(R):5'- CTTGACTACCGCTACAAC -3'

Posted On

2020-01-23