Incidental Mutation 'R8029:Lpar3'
ID617811
Institutional Source Beutler Lab
Gene Symbol Lpar3
Ensembl Gene ENSMUSG00000036832
Gene Namelysophosphatidic acid receptor 3
SynonymsEdg7, LPA3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location146220963-146286186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146240963 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 132 (M132T)
Ref Sequence ENSEMBL: ENSMUSP00000037712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039164]
Predicted Effect probably benign
Transcript: ENSMUST00000039164
AA Change: M132T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000037712
Gene: ENSMUSG00000036832
AA Change: M132T

DomainStartEndE-ValueType
Pfam:7tm_1 47 293 2.4e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor family, as well as the EDG family of proteins. This protein functions as a cellular receptor for lysophosphatidic acid and mediates lysophosphatidic acid-evoked calcium mobilization. This receptor couples predominantly to G(q/11) alpha proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females produce smaller litter sizes and exhibit delayed implantation and altered embryo spacing that leads to delayed development of embryos and hypertrophic placentas that were shared by multiple embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Lpar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02444:Lpar3 APN 3 146241194 missense probably damaging 1.00
R0656:Lpar3 UTSW 3 146240671 missense possibly damaging 0.54
R0893:Lpar3 UTSW 3 146240593 missense possibly damaging 0.82
R1809:Lpar3 UTSW 3 146240548 splice site probably benign
R4937:Lpar3 UTSW 3 146284751 missense probably damaging 0.98
R6116:Lpar3 UTSW 3 146240597 missense possibly damaging 0.70
R6587:Lpar3 UTSW 3 146241163 missense probably damaging 1.00
R7232:Lpar3 UTSW 3 146241306 critical splice donor site probably null
R8266:Lpar3 UTSW 3 146240630 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTGCTGCGGATTTCTTCG -3'
(R):5'- TACCGCCACCATGATGAAG -3'

Sequencing Primer
(F):5'- CGGATTTCTTCGCCGGAATCG -3'
(R):5'- CCAGGAGGTTGGACACAGTC -3'
Posted On2020-01-23