Incidental Mutation 'R8029:Nudt9'
ID 617813
Institutional Source Beutler Lab
Gene Symbol Nudt9
Ensembl Gene ENSMUSG00000029310
Gene Name nudix hydrolase 9
Synonyms nudix (nucleoside diphosphate linked moiety X)-type motif 9, 1190002C07Rik
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.210) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 104194172-104213245 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 104198477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031250] [ENSMUST00000128511] [ENSMUST00000134313] [ENSMUST00000148261] [ENSMUST00000150226]
AlphaFold Q8BVU5
Predicted Effect silent
Transcript: ENSMUST00000031250
SMART Domains Protein: ENSMUSP00000031250
Gene: ENSMUSG00000029310

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
Pfam:NUDIX 189 334 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128511
SMART Domains Protein: ENSMUSP00000119820
Gene: ENSMUSG00000029310

DomainStartEndE-ValueType
PDB:1QVJ|A 9 158 1e-89 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134313
SMART Domains Protein: ENSMUSP00000117181
Gene: ENSMUSG00000029310

DomainStartEndE-ValueType
PDB:1QVJ|A 9 152 2e-84 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000148261
SMART Domains Protein: ENSMUSP00000115170
Gene: ENSMUSG00000029310

DomainStartEndE-ValueType
PDB:1QVJ|A 9 110 2e-68 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150226
SMART Domains Protein: ENSMUSP00000114631
Gene: ENSMUSG00000029310

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
Pfam:NUDIX 131 207 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Arhgef1 T C 7: 24,619,163 (GRCm39) L468P probably damaging Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Asb3 A T 11: 31,051,180 (GRCm39) R506* probably null Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Idua T C 5: 108,817,278 (GRCm39) F17S probably benign Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nectin4 A G 1: 171,214,255 (GRCm39) D470G probably benign Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nphp1 T C 2: 127,583,036 (GRCm39) T626A probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Or7g20 T C 9: 18,947,090 (GRCm39) S224P probably damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Ppp1r9a A G 6: 5,057,518 (GRCm39) E531G possibly damaging Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Urb1 A G 16: 90,576,040 (GRCm39) S839P possibly damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Nudt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Nudt9 APN 5 104,209,628 (GRCm39) unclassified probably benign
IGL01398:Nudt9 APN 5 104,212,979 (GRCm39) makesense probably null
IGL01910:Nudt9 APN 5 104,202,175 (GRCm39) missense probably damaging 0.96
IGL02441:Nudt9 APN 5 104,212,885 (GRCm39) missense probably benign 0.01
IGL03207:Nudt9 APN 5 104,206,092 (GRCm39) splice site probably benign
steady UTSW 5 104,205,977 (GRCm39) missense probably damaging 1.00
streak UTSW 5 104,198,487 (GRCm39) start codon destroyed possibly damaging 0.89
Struck UTSW 5 104,212,904 (GRCm39) nonsense probably null
R0136:Nudt9 UTSW 5 104,194,972 (GRCm39) missense probably benign
R0227:Nudt9 UTSW 5 104,209,541 (GRCm39) missense possibly damaging 0.90
R0652:Nudt9 UTSW 5 104,198,467 (GRCm39) missense possibly damaging 0.48
R0755:Nudt9 UTSW 5 104,212,920 (GRCm39) missense probably damaging 0.98
R1156:Nudt9 UTSW 5 104,198,596 (GRCm39) nonsense probably null
R1462:Nudt9 UTSW 5 104,212,904 (GRCm39) nonsense probably null
R1462:Nudt9 UTSW 5 104,212,904 (GRCm39) nonsense probably null
R1962:Nudt9 UTSW 5 104,212,971 (GRCm39) missense probably benign
R2697:Nudt9 UTSW 5 104,212,859 (GRCm39) missense probably damaging 1.00
R2916:Nudt9 UTSW 5 104,203,424 (GRCm39) missense probably damaging 1.00
R3780:Nudt9 UTSW 5 104,194,972 (GRCm39) missense probably benign
R3972:Nudt9 UTSW 5 104,194,991 (GRCm39) missense probably benign 0.00
R4354:Nudt9 UTSW 5 104,205,977 (GRCm39) missense probably damaging 1.00
R5325:Nudt9 UTSW 5 104,198,487 (GRCm39) start codon destroyed possibly damaging 0.89
R5652:Nudt9 UTSW 5 104,207,646 (GRCm39) missense probably benign 0.19
R6087:Nudt9 UTSW 5 104,198,679 (GRCm39) missense probably benign 0.00
R6240:Nudt9 UTSW 5 104,194,955 (GRCm39) missense probably benign 0.31
R6241:Nudt9 UTSW 5 104,202,151 (GRCm39) missense probably damaging 0.98
R6280:Nudt9 UTSW 5 104,212,935 (GRCm39) missense probably benign
R6719:Nudt9 UTSW 5 104,209,562 (GRCm39) missense probably damaging 1.00
R6865:Nudt9 UTSW 5 104,207,545 (GRCm39) missense probably damaging 1.00
R7225:Nudt9 UTSW 5 104,212,966 (GRCm39) missense probably benign
R7629:Nudt9 UTSW 5 104,198,560 (GRCm39) missense possibly damaging 0.90
R7685:Nudt9 UTSW 5 104,194,946 (GRCm39) nonsense probably null
R8027:Nudt9 UTSW 5 104,212,793 (GRCm39) splice site probably benign
X0063:Nudt9 UTSW 5 104,198,560 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGGTTTTGAGAGTCTCTC -3'
(R):5'- TCTGCTCACCTGATCTGAGG -3'

Sequencing Primer
(F):5'- AACAGCTTGCCTTAGAGGTC -3'
(R):5'- TCACCTGATCTGAGGGTCCG -3'
Posted On 2020-01-23