Incidental Mutation 'R8029:Idua'
ID617814
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Nameiduronidase, alpha-L-
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location108660331-108684557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108669412 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 17 (F17S)
Ref Sequence ENSEMBL: ENSMUSP00000071577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051757] [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000119270] [ENSMUST00000132708] [ENSMUST00000136227] [ENSMUST00000139734] [ENSMUST00000140620] [ENSMUST00000163328]
Predicted Effect probably benign
Transcript: ENSMUST00000051757
SMART Domains Protein: ENSMUSP00000051561
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071650
AA Change: F17S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112563
AA Change: F17S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119212
AA Change: F17S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119270
SMART Domains Protein: ENSMUSP00000113185
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_transp 85 498 7.3e-135 PFAM
Pfam:STAS 552 702 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136227
SMART Domains Protein: ENSMUSP00000116540
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 3.4e-31 PFAM
Pfam:Sulfate_transp 200 416 2.2e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139734
AA Change: F17S

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
AA Change: F17S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163328
SMART Domains Protein: ENSMUSP00000131282
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108680871 missense probably benign 0.34
IGL01575:Idua APN 5 108682107 missense possibly damaging 0.71
IGL02402:Idua APN 5 108679791 missense probably damaging 1.00
IGL03145:Idua APN 5 108681496 missense probably benign
Cooper UTSW 5 108680314 missense probably damaging 1.00
R0208:Idua UTSW 5 108681752 missense probably damaging 1.00
R1572:Idua UTSW 5 108680589 missense probably benign
R1731:Idua UTSW 5 108681672 missense probably benign 0.00
R2024:Idua UTSW 5 108680734 missense probably damaging 1.00
R2126:Idua UTSW 5 108681438 missense possibly damaging 0.93
R3760:Idua UTSW 5 108670112 unclassified probably benign
R4747:Idua UTSW 5 108681036 missense probably damaging 0.97
R4832:Idua UTSW 5 108669381 missense probably benign
R5140:Idua UTSW 5 108680314 missense probably damaging 1.00
R5543:Idua UTSW 5 108670229 missense probably benign 0.22
R5643:Idua UTSW 5 108680224 utr 3 prime probably benign
R5821:Idua UTSW 5 108679734 missense probably benign 0.29
R6004:Idua UTSW 5 108680644 missense probably benign
R6330:Idua UTSW 5 108681708 missense probably benign 0.21
R6963:Idua UTSW 5 108679775 missense possibly damaging 0.84
R7180:Idua UTSW 5 108680895 missense probably benign 0.43
R7453:Idua UTSW 5 108681496 missense probably benign
R7575:Idua UTSW 5 108681699 missense probably damaging 1.00
R7712:Idua UTSW 5 108681522 missense probably benign 0.10
R7923:Idua UTSW 5 108680583 missense probably damaging 1.00
R7980:Idua UTSW 5 108680620 missense probably benign 0.00
R8026:Idua UTSW 5 108670249 missense probably benign 0.01
R8074:Idua UTSW 5 108680575 missense possibly damaging 0.65
R8089:Idua UTSW 5 108681780 missense probably damaging 1.00
R8384:Idua UTSW 5 108681439 missense possibly damaging 0.70
Z1177:Idua UTSW 5 108679584 missense probably null 0.80
Z1177:Idua UTSW 5 108680623 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCACTGCTAATGTTGGTTCC -3'
(R):5'- TTCGCTTCTGAGTGTCCAGG -3'

Sequencing Primer
(F):5'- CCATTTTTGGAGCGCCTG -3'
(R):5'- GCCCAAAGCTGTAATGGGG -3'
Posted On2020-01-23