Incidental Mutation 'R8029:Idua'
ID 617814
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Name iduronidase, alpha-L
Synonyms
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 108808197-108832423 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108817278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 17 (F17S)
Ref Sequence ENSEMBL: ENSMUSP00000071577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051757] [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000119270] [ENSMUST00000132708] [ENSMUST00000136227] [ENSMUST00000139734] [ENSMUST00000140620] [ENSMUST00000163328]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051757
SMART Domains Protein: ENSMUSP00000051561
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071650
AA Change: F17S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112563
AA Change: F17S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119212
AA Change: F17S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119270
SMART Domains Protein: ENSMUSP00000113185
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_transp 85 498 7.3e-135 PFAM
Pfam:STAS 552 702 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136227
SMART Domains Protein: ENSMUSP00000116540
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 3.4e-31 PFAM
Pfam:Sulfate_transp 200 416 2.2e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139734
AA Change: F17S

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
AA Change: F17S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540
AA Change: F17S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163328
SMART Domains Protein: ENSMUSP00000131282
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Arhgef1 T C 7: 24,619,163 (GRCm39) L468P probably damaging Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Asb3 A T 11: 31,051,180 (GRCm39) R506* probably null Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nectin4 A G 1: 171,214,255 (GRCm39) D470G probably benign Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nphp1 T C 2: 127,583,036 (GRCm39) T626A probably benign Het
Nudt9 C T 5: 104,198,477 (GRCm39) probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Or7g20 T C 9: 18,947,090 (GRCm39) S224P probably damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Ppp1r9a A G 6: 5,057,518 (GRCm39) E531G possibly damaging Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Urb1 A G 16: 90,576,040 (GRCm39) S839P possibly damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108,828,737 (GRCm39) missense probably benign 0.34
IGL01575:Idua APN 5 108,829,973 (GRCm39) missense possibly damaging 0.71
IGL02402:Idua APN 5 108,827,657 (GRCm39) missense probably damaging 1.00
IGL03145:Idua APN 5 108,829,362 (GRCm39) missense probably benign
Cooper UTSW 5 108,828,180 (GRCm39) missense probably damaging 1.00
R0208:Idua UTSW 5 108,829,618 (GRCm39) missense probably damaging 1.00
R1572:Idua UTSW 5 108,828,455 (GRCm39) missense probably benign
R1731:Idua UTSW 5 108,829,538 (GRCm39) missense probably benign 0.00
R2024:Idua UTSW 5 108,828,600 (GRCm39) missense probably damaging 1.00
R2126:Idua UTSW 5 108,829,304 (GRCm39) missense possibly damaging 0.93
R3760:Idua UTSW 5 108,817,978 (GRCm39) unclassified probably benign
R4747:Idua UTSW 5 108,828,902 (GRCm39) missense probably damaging 0.97
R4832:Idua UTSW 5 108,817,247 (GRCm39) missense probably benign
R5140:Idua UTSW 5 108,828,180 (GRCm39) missense probably damaging 1.00
R5543:Idua UTSW 5 108,818,095 (GRCm39) missense probably benign 0.22
R5643:Idua UTSW 5 108,828,090 (GRCm39) utr 3 prime probably benign
R5821:Idua UTSW 5 108,827,600 (GRCm39) missense probably benign 0.29
R6004:Idua UTSW 5 108,828,510 (GRCm39) missense probably benign
R6330:Idua UTSW 5 108,829,574 (GRCm39) missense probably benign 0.21
R6963:Idua UTSW 5 108,827,641 (GRCm39) missense possibly damaging 0.84
R7180:Idua UTSW 5 108,828,761 (GRCm39) missense probably benign 0.43
R7453:Idua UTSW 5 108,829,362 (GRCm39) missense probably benign
R7575:Idua UTSW 5 108,829,565 (GRCm39) missense probably damaging 1.00
R7712:Idua UTSW 5 108,829,388 (GRCm39) missense probably benign 0.10
R7923:Idua UTSW 5 108,828,449 (GRCm39) missense probably damaging 1.00
R7980:Idua UTSW 5 108,828,486 (GRCm39) missense probably benign 0.00
R8026:Idua UTSW 5 108,818,115 (GRCm39) missense probably benign 0.01
R8074:Idua UTSW 5 108,828,441 (GRCm39) missense possibly damaging 0.65
R8089:Idua UTSW 5 108,829,646 (GRCm39) missense probably damaging 1.00
R8384:Idua UTSW 5 108,829,305 (GRCm39) missense possibly damaging 0.70
R9040:Idua UTSW 5 108,828,929 (GRCm39) missense probably damaging 1.00
R9717:Idua UTSW 5 108,818,037 (GRCm39) nonsense probably null
Z1177:Idua UTSW 5 108,828,489 (GRCm39) frame shift probably null
Z1177:Idua UTSW 5 108,827,450 (GRCm39) missense probably null 0.80
Predicted Primers PCR Primer
(F):5'- AGCACTGCTAATGTTGGTTCC -3'
(R):5'- TTCGCTTCTGAGTGTCCAGG -3'

Sequencing Primer
(F):5'- CCATTTTTGGAGCGCCTG -3'
(R):5'- GCCCAAAGCTGTAATGGGG -3'
Posted On 2020-01-23