Mutagenetix > Incidental Mutation

Incidental Mutation 'R8029:Grk3'

617815

Institutional Source

Beutler Lab

Gene Symbol

Grk3

Ensembl Gene

ENSMUSG00000042249

Gene Name

G protein-coupled receptor kinase 3

Synonyms

4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8029 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112910482-113015791 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 112961642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 150 (I150L)

Ref Sequence

ENSEMBL: ENSMUSP00000070445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197776] [ENSMUST00000197888] [ENSMUST00000200332]

AlphaFold

Q3UYH7

Predicted Effect

probably benign
Transcript: ENSMUST00000065167
AA Change: I150L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: I150L

Domain	Start	End	E-Value	Type
RGS	54	175	1.44e-28	SMART
S_TKc	191	453	8.94e-85	SMART
S_TK_X	454	530	2.19e-10	SMART
PH	559	654	8.45e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000197776
AA Change: I150L

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000143427
Gene: ENSMUSG00000042249
AA Change: I150L

Domain	Start	End	E-Value	Type
RGS	54	170	7.71e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197888
AA Change: I108L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249
AA Change: I108L

Domain	Start	End	E-Value	Type
RGS	12	133	1.44e-28	SMART
S_TKc	149	411	8.94e-85	SMART
S_TK_X	412	488	2.19e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200332

SMART Domains

Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

Domain	Start	End	E-Value	Type
PDB:3V5W\|A	1	88	6e-42	PDB
SCOP:d1dk8a_	48	88	2e-4	SMART
Blast:RGS	54	88	1e-18	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,377	H543R	possibly damaging	Het
Acvr1c	A	G	2: 58,296,117	I118T	possibly damaging	Het
Alpk1	T	C	3: 127,729,285	D36G	possibly damaging	Het
Aox2	G	A	1: 58,343,668	V1036I	probably benign	Het
Arhgef1	T	C	7: 24,919,738	L468P	probably damaging	Het
Armc2	A	T	10: 41,927,000	L559Q	probably damaging	Het
Asb3	A	T	11: 31,101,180	R506*	probably null	Het
Asna1	T	C	8: 85,019,827	M131V	probably benign	Het
Aspm	A	G	1: 139,471,632	H1045R	probably benign	Het
Cacna1g	G	T	11: 94,409,738	R2099S	probably benign	Het
Cd177	C	T	7: 24,756,169	W309*	probably null	Het
Cd34	A	C	1: 194,958,552	M242L	probably benign	Het
Cdh24	T	A	14: 54,639,399	N49I	probably damaging	Het
Ces2b	A	G	8: 104,834,850	N192S	probably damaging	Het
Chsy3	A	G	18: 59,179,447	I331V	possibly damaging	Het
Disp1	A	G	1: 183,089,288	S523P	probably damaging	Het
Dlgap5	T	C	14: 47,416,440	H44R	probably benign	Het
Dnajc30	G	T	5: 135,064,332	A28S	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Exd1	A	T	2: 119,528,723	H226Q	probably damaging	Het
Gata6	T	A	18: 11,054,944	V291E	possibly damaging	Het
Gfi1b	A	T	2: 28,613,675		probably null	Het
Gstcd	C	T	3: 133,082,107	V277M	probably damaging	Het
Idua	T	C	5: 108,669,412	F17S	probably benign	Het
Ighg1	T	C	12: 113,329,145	K268R		Het
Lama1	G	T	17: 67,817,594	R2883M		Het
Lpar3	T	C	3: 146,240,963	M132T	probably benign	Het
Macf1	T	C	4: 123,444,892	T4351A	possibly damaging	Het
March6	A	G	15: 31,496,002		probably null	Het
Mbtps1	C	A	8: 119,547,805		probably benign	Het
Mctp1	T	C	13: 77,029,886	Y931H	probably damaging	Het
Mug2	A	G	6: 122,081,545		probably null	Het
Myh1	G	T	11: 67,211,240		probably null	Het
Mylk2	T	C	2: 152,920,299	S497P	probably damaging	Het
Nectin4	A	G	1: 171,386,687	D470G	probably benign	Het
Nop2	C	T	6: 125,144,420	P722S	possibly damaging	Het
Nphp1	T	C	2: 127,741,116	T626A	probably benign	Het
Nudt9	C	T	5: 104,050,611		probably benign	Het
Olfr1145	A	G	2: 87,810,032	T71A	probably benign	Het
Olfr18	A	G	9: 20,314,347	F191S	possibly damaging	Het
Olfr512	T	A	7: 108,713,830	F159Y	possibly damaging	Het
Olfr835	T	C	9: 19,035,794	S224P	probably damaging	Het
Oplah	T	C	15: 76,305,696	Y143C	probably benign	Het
Osbpl1a	T	G	18: 12,914,521	E125D	probably benign	Het
P2ry1	C	A	3: 61,003,522	N27K	possibly damaging	Het
Palld	A	T	8: 61,877,312	I177N	probably damaging	Het
Plcl1	A	T	1: 55,696,078	I193L	probably benign	Het
Polr1a	T	A	6: 71,912,956	L53*	probably null	Het
Ppp1r9a	A	G	6: 5,057,518	E531G	possibly damaging	Het
Prex1	C	A	2: 166,575,603	Q1361H	probably benign	Het
Ptprc	T	C	1: 138,078,459	E795G	probably damaging	Het
Rars	C	T	11: 35,821,165	V295I	probably damaging	Het
Rnaseh2b	T	C	14: 62,353,548	V116A	possibly damaging	Het
Rnf43	T	A	11: 87,731,894	L480H	probably benign	Het
Rttn	A	G	18: 89,090,474	T1601A	not run	Het
Setd1a	C	G	7: 127,786,214	Q698E	probably benign	Het
Sh3gl3	T	C	7: 82,270,883	Y100H	probably benign	Het
Sis	T	C	3: 72,921,142	Y1200C	probably damaging	Het
Snx13	A	C	12: 35,119,886	H610P	probably damaging	Het
Spdl1	T	C	11: 34,822,592	R217G	probably benign	Het
Spop	G	A	11: 95,474,367	E113K	probably benign	Het
Sult2a3	G	A	7: 14,121,628	P101L	probably damaging	Het
Tbl1xr1	C	T	3: 22,200,436	H348Y	probably damaging	Het
Tmie	T	C	9: 110,867,487	T109A	possibly damaging	Het
Ttc12	A	G	9: 49,470,251	V140A	possibly damaging	Het
Ube2m	A	G	7: 13,036,597	L58P	probably damaging	Het
Urb1	A	G	16: 90,779,152	S839P	possibly damaging	Het
Vmn2r117	T	A	17: 23,477,770	D221V	probably benign	Het
Vps41	C	T	13: 18,823,785	Q263*	probably null	Het
Zfand3	A	T	17: 30,135,433	T75S	probably benign	Het
Zscan26	A	G	13: 21,445,350	C202R	probably damaging	Het

Other mutations in Grk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00974:Grk3	APN	5	112985819	missense	probably damaging	1.00
IGL01359:Grk3	APN	5	112937760	missense	probably damaging	1.00
IGL02318:Grk3	APN	5	112937803	missense	probably damaging	1.00
IGL02612:Grk3	APN	5	112969234	missense	probably benign	0.27
R0142:Grk3	UTSW	5	112915053	missense	probably damaging	1.00
R0589:Grk3	UTSW	5	112928763	splice site	probably benign
R0607:Grk3	UTSW	5	112920053	missense	probably damaging	1.00
R1459:Grk3	UTSW	5	112915012	missense	probably benign	0.10
R1554:Grk3	UTSW	5	112969269	missense	possibly damaging	0.76
R1640:Grk3	UTSW	5	113015382	missense	probably benign	0.36
R1657:Grk3	UTSW	5	112966982	missense	probably damaging	1.00
R1789:Grk3	UTSW	5	112941718	missense	probably damaging	1.00
R2401:Grk3	UTSW	5	112914983	missense	probably benign
R3735:Grk3	UTSW	5	112953831	missense	probably benign	0.00
R4024:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4025:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4392:Grk3	UTSW	5	112920136	missense	probably damaging	1.00
R4439:Grk3	UTSW	5	112946677	splice site	probably null
R4589:Grk3	UTSW	5	112941718	missense	possibly damaging	0.87
R4646:Grk3	UTSW	5	112929720	missense	probably benign	0.04
R5154:Grk3	UTSW	5	112941717	missense	probably damaging	1.00
R5462:Grk3	UTSW	5	112969208	missense	probably damaging	1.00
R5764:Grk3	UTSW	5	112966910	critical splice donor site	probably null
R5790:Grk3	UTSW	5	112966976	missense	possibly damaging	0.80
R6516:Grk3	UTSW	5	112961549	intron	probably benign
R6848:Grk3	UTSW	5	112985775	missense	probably damaging	0.98
R7857:Grk3	UTSW	5	112961561	missense	unknown
R7873:Grk3	UTSW	5	112929686	missense	probably benign	0.03
R8132:Grk3	UTSW	5	112961489	missense	unknown
R8204:Grk3	UTSW	5	112957359	missense	probably benign	0.17
R8903:Grk3	UTSW	5	112918831	missense	possibly damaging	0.89
R9450:Grk3	UTSW	5	112915047	missense	probably benign	0.06
R9794:Grk3	UTSW	5	112973582	critical splice acceptor site	probably null
RF021:Grk3	UTSW	5	112941688	missense	probably benign	0.20
Z1176:Grk3	UTSW	5	112957314	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGGCTACATACCCCAGAGATAC -3'
(R):5'- GTGTGCAATGCAGTAGGAGC -3'

Sequencing Primer
(F):5'- CAGAGATACAACATAAAGCATCAAGG -3'
(R):5'- TGATAATCCTGGAATGAGCCG -3'

Posted On

2020-01-23