Incidental Mutation 'R8029:Ppp1r9a'
ID 617817
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Name protein phosphatase 1, regulatory subunit 9A
Synonyms NRB, neurabin-I, Neurabin I, A230094E16Rik, 4930518N04Rik, 2810430P21Rik
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 4902917-5165661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5057518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 531 (E531G)
Ref Sequence ENSEMBL: ENSMUSP00000135629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000168998] [ENSMUST00000175889] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177456]
AlphaFold H3BJD6
Predicted Effect possibly damaging
Transcript: ENSMUST00000035813
AA Change: E531G

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: E531G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168998
AA Change: E531G

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126643
Gene: ENSMUSG00000032827
AA Change: E531G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175889
AA Change: E531G

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: E531G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176263
AA Change: E531G

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: E531G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176729
AA Change: E211G

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827
AA Change: E211G

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177153
AA Change: E531G

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: E531G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177456
AA Change: E531G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: E531G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Arhgef1 T C 7: 24,619,163 (GRCm39) L468P probably damaging Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Asb3 A T 11: 31,051,180 (GRCm39) R506* probably null Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Idua T C 5: 108,817,278 (GRCm39) F17S probably benign Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nectin4 A G 1: 171,214,255 (GRCm39) D470G probably benign Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nphp1 T C 2: 127,583,036 (GRCm39) T626A probably benign Het
Nudt9 C T 5: 104,198,477 (GRCm39) probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Or7g20 T C 9: 18,947,090 (GRCm39) S224P probably damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Urb1 A G 16: 90,576,040 (GRCm39) S839P possibly damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5,158,195 (GRCm39) missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5,157,014 (GRCm39) missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5,157,023 (GRCm39) missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5,115,322 (GRCm39) missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5,064,003 (GRCm39) missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5,158,248 (GRCm39) nonsense probably null
IGL02126:Ppp1r9a APN 6 5,156,229 (GRCm39) missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4,906,537 (GRCm39) missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5,046,015 (GRCm39) missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5,110,993 (GRCm39) splice site probably benign
R0545:Ppp1r9a UTSW 6 5,115,357 (GRCm39) missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4,906,795 (GRCm39) missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5,159,697 (GRCm39) missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5,057,557 (GRCm39) missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5,113,712 (GRCm39) nonsense probably null
R1545:Ppp1r9a UTSW 6 5,156,242 (GRCm39) critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4,906,168 (GRCm39) missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5,111,060 (GRCm39) splice site probably benign
R1834:Ppp1r9a UTSW 6 5,113,710 (GRCm39) missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4,906,348 (GRCm39) missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2227:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2898:Ppp1r9a UTSW 6 4,906,558 (GRCm39) missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5,113,674 (GRCm39) missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4,906,259 (GRCm39) unclassified probably benign
R3927:Ppp1r9a UTSW 6 5,057,531 (GRCm39) missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4,906,537 (GRCm39) missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4,905,477 (GRCm39) missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5,157,016 (GRCm39) missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5,156,177 (GRCm39) missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5,115,367 (GRCm39) missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5,159,702 (GRCm39) missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5,134,363 (GRCm39) intron probably benign
R5828:Ppp1r9a UTSW 6 5,158,200 (GRCm39) missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5,159,648 (GRCm39) missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5,157,002 (GRCm39) critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5,134,660 (GRCm39) missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4,906,363 (GRCm39) missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4,905,509 (GRCm39) missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5,110,715 (GRCm39) intron probably benign
R6175:Ppp1r9a UTSW 6 4,905,639 (GRCm39) nonsense probably null
R6188:Ppp1r9a UTSW 6 5,158,113 (GRCm39) nonsense probably null
R6233:Ppp1r9a UTSW 6 5,077,610 (GRCm39) missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5,115,151 (GRCm39) missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5,057,458 (GRCm39) missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4,905,827 (GRCm39) missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5,045,949 (GRCm39) missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4,905,670 (GRCm39) missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5,134,804 (GRCm39) missense probably benign
R7238:Ppp1r9a UTSW 6 5,159,716 (GRCm39) missense probably damaging 1.00
R7438:Ppp1r9a UTSW 6 5,115,378 (GRCm39) missense probably damaging 0.99
R7497:Ppp1r9a UTSW 6 4,905,775 (GRCm39) missense probably damaging 1.00
R7666:Ppp1r9a UTSW 6 5,143,238 (GRCm39) missense probably benign 0.00
R7698:Ppp1r9a UTSW 6 4,906,430 (GRCm39) missense probably benign
R7850:Ppp1r9a UTSW 6 4,905,894 (GRCm39) missense possibly damaging 0.77
R8392:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R8411:Ppp1r9a UTSW 6 5,057,568 (GRCm39) missense probably damaging 1.00
R8431:Ppp1r9a UTSW 6 5,115,456 (GRCm39) missense probably benign 0.01
R8699:Ppp1r9a UTSW 6 5,115,474 (GRCm39) missense probably benign 0.00
R8708:Ppp1r9a UTSW 6 5,115,196 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r9a UTSW 6 5,134,657 (GRCm39) missense probably benign 0.00
R9096:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9097:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9131:Ppp1r9a UTSW 6 5,134,106 (GRCm39) missense possibly damaging 0.86
R9279:Ppp1r9a UTSW 6 5,113,757 (GRCm39) missense probably damaging 1.00
R9512:Ppp1r9a UTSW 6 5,115,364 (GRCm39) missense probably damaging 0.99
R9512:Ppp1r9a UTSW 6 5,113,681 (GRCm39) missense probably benign 0.27
R9567:Ppp1r9a UTSW 6 5,157,004 (GRCm39) missense probably benign 0.34
R9672:Ppp1r9a UTSW 6 5,007,889 (GRCm39) missense unknown
R9687:Ppp1r9a UTSW 6 4,905,978 (GRCm39) missense probably damaging 1.00
R9715:Ppp1r9a UTSW 6 5,045,936 (GRCm39) missense probably damaging 0.96
RF007:Ppp1r9a UTSW 6 4,906,657 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGACTCTCAATCTATGGAG -3'
(R):5'- ATCACTTCACACTGTGTAAGCAC -3'

Sequencing Primer
(F):5'- GAGACAAACCTACAATGCCCTGTG -3'
(R):5'- GCAGACAGACAGATGCACACTTAG -3'
Posted On 2020-01-23