Mutagenetix > Incidental Mutation

Incidental Mutation 'R8029:Polr1a'

617818

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

067468-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8029 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 71912956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 53 (L53*)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000082094] [ENSMUST00000206556] [ENSMUST00000206879]

AlphaFold

O35134

Predicted Effect

probably null
Transcript: ENSMUST00000055296
AA Change: L53*

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: L53*

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000082094

SMART Domains

Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884

Domain	Start	End	E-Value	Type
low complexity region	2	8	N/A	INTRINSIC
low complexity region	216	227	N/A	INTRINSIC
Pfam:PPR_2	253	300	1.4e-10	PFAM
Pfam:PPR_3	331	366	2.1e-4	PFAM
low complexity region	671	684	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206284

Predicted Effect

probably null
Transcript: ENSMUST00000206556
AA Change: L53*

Predicted Effect

probably benign
Transcript: ENSMUST00000206879

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,377	H543R	possibly damaging	Het
Acvr1c	A	G	2: 58,296,117	I118T	possibly damaging	Het
Alpk1	T	C	3: 127,729,285	D36G	possibly damaging	Het
Aox2	G	A	1: 58,343,668	V1036I	probably benign	Het
Arhgef1	T	C	7: 24,919,738	L468P	probably damaging	Het
Armc2	A	T	10: 41,927,000	L559Q	probably damaging	Het
Asb3	A	T	11: 31,101,180	R506*	probably null	Het
Asna1	T	C	8: 85,019,827	M131V	probably benign	Het
Aspm	A	G	1: 139,471,632	H1045R	probably benign	Het
Cacna1g	G	T	11: 94,409,738	R2099S	probably benign	Het
Cd177	C	T	7: 24,756,169	W309*	probably null	Het
Cd34	A	C	1: 194,958,552	M242L	probably benign	Het
Cdh24	T	A	14: 54,639,399	N49I	probably damaging	Het
Ces2b	A	G	8: 104,834,850	N192S	probably damaging	Het
Chsy3	A	G	18: 59,179,447	I331V	possibly damaging	Het
Disp1	A	G	1: 183,089,288	S523P	probably damaging	Het
Dlgap5	T	C	14: 47,416,440	H44R	probably benign	Het
Dnajc30	G	T	5: 135,064,332	A28S	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Exd1	A	T	2: 119,528,723	H226Q	probably damaging	Het
Gata6	T	A	18: 11,054,944	V291E	possibly damaging	Het
Gfi1b	A	T	2: 28,613,675		probably null	Het
Grk3	T	A	5: 112,961,642	I150L	probably benign	Het
Gstcd	C	T	3: 133,082,107	V277M	probably damaging	Het
Idua	T	C	5: 108,669,412	F17S	probably benign	Het
Ighg1	T	C	12: 113,329,145	K268R		Het
Lama1	G	T	17: 67,817,594	R2883M		Het
Lpar3	T	C	3: 146,240,963	M132T	probably benign	Het
Macf1	T	C	4: 123,444,892	T4351A	possibly damaging	Het
March6	A	G	15: 31,496,002		probably null	Het
Mbtps1	C	A	8: 119,547,805		probably benign	Het
Mctp1	T	C	13: 77,029,886	Y931H	probably damaging	Het
Mug2	A	G	6: 122,081,545		probably null	Het
Myh1	G	T	11: 67,211,240		probably null	Het
Mylk2	T	C	2: 152,920,299	S497P	probably damaging	Het
Nectin4	A	G	1: 171,386,687	D470G	probably benign	Het
Nop2	C	T	6: 125,144,420	P722S	possibly damaging	Het
Nphp1	T	C	2: 127,741,116	T626A	probably benign	Het
Nudt9	C	T	5: 104,050,611		probably benign	Het
Olfr1145	A	G	2: 87,810,032	T71A	probably benign	Het
Olfr18	A	G	9: 20,314,347	F191S	possibly damaging	Het
Olfr512	T	A	7: 108,713,830	F159Y	possibly damaging	Het
Olfr835	T	C	9: 19,035,794	S224P	probably damaging	Het
Oplah	T	C	15: 76,305,696	Y143C	probably benign	Het
Osbpl1a	T	G	18: 12,914,521	E125D	probably benign	Het
P2ry1	C	A	3: 61,003,522	N27K	possibly damaging	Het
Palld	A	T	8: 61,877,312	I177N	probably damaging	Het
Plcl1	A	T	1: 55,696,078	I193L	probably benign	Het
Ppp1r9a	A	G	6: 5,057,518	E531G	possibly damaging	Het
Prex1	C	A	2: 166,575,603	Q1361H	probably benign	Het
Ptprc	T	C	1: 138,078,459	E795G	probably damaging	Het
Rars	C	T	11: 35,821,165	V295I	probably damaging	Het
Rnaseh2b	T	C	14: 62,353,548	V116A	possibly damaging	Het
Rnf43	T	A	11: 87,731,894	L480H	probably benign	Het
Rttn	A	G	18: 89,090,474	T1601A	not run	Het
Setd1a	C	G	7: 127,786,214	Q698E	probably benign	Het
Sh3gl3	T	C	7: 82,270,883	Y100H	probably benign	Het
Sis	T	C	3: 72,921,142	Y1200C	probably damaging	Het
Snx13	A	C	12: 35,119,886	H610P	probably damaging	Het
Spdl1	T	C	11: 34,822,592	R217G	probably benign	Het
Spop	G	A	11: 95,474,367	E113K	probably benign	Het
Sult2a3	G	A	7: 14,121,628	P101L	probably damaging	Het
Tbl1xr1	C	T	3: 22,200,436	H348Y	probably damaging	Het
Tmie	T	C	9: 110,867,487	T109A	possibly damaging	Het
Ttc12	A	G	9: 49,470,251	V140A	possibly damaging	Het
Ube2m	A	G	7: 13,036,597	L58P	probably damaging	Het
Urb1	A	G	16: 90,779,152	S839P	possibly damaging	Het
Vmn2r117	T	A	17: 23,477,770	D221V	probably benign	Het
Vps41	C	T	13: 18,823,785	Q263*	probably null	Het
Zfand3	A	T	17: 30,135,433	T75S	probably benign	Het
Zscan26	A	G	13: 21,445,350	C202R	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGGTCTGGCTTATAACCTGCC -3'
(R):5'- AGGGTGTACAGTTTCTAGGTCC -3'

Sequencing Primer
(F):5'- CTCTCCCACTTCAACCTCAGAGAAG -3'
(R):5'- GGTGTACAGTTTCTAGGTCCATAAAG -3'

Posted On

2020-01-23