Incidental Mutation 'R8029:Ube2m'
ID617821
Institutional Source Beutler Lab
Gene Symbol Ube2m
Ensembl Gene ENSMUSG00000005575
Gene Nameubiquitin-conjugating enzyme E2M
SynonymsUbc-rs2, UBC12, 2510040H03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location13035120-13038275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13036597 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 58 (L58P)
Ref Sequence ENSEMBL: ENSMUSP00000005714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005711] [ENSMUST00000005714] [ENSMUST00000125964] [ENSMUST00000165394] [ENSMUST00000210587] [ENSMUST00000211344] [ENSMUST00000211369] [ENSMUST00000211626]
Predicted Effect probably benign
Transcript: ENSMUST00000005711
SMART Domains Protein: ENSMUSP00000005711
Gene: ENSMUSG00000033916

DomainStartEndE-ValueType
Pfam:Snf7 17 187 9.5e-50 PFAM
coiled coil region 196 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000005714
AA Change: L58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005714
Gene: ENSMUSG00000005575
AA Change: L58P

DomainStartEndE-ValueType
UBCc 32 173 8.83e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123541
AA Change: L17P

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120234
Gene: ENSMUSG00000005575
AA Change: L17P

DomainStartEndE-ValueType
UBCc 1 162 2.43e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125964
AA Change: L46P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122638
Gene: ENSMUSG00000005575
AA Change: L46P

DomainStartEndE-ValueType
UBCc 20 161 3.67e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165394
SMART Domains Protein: ENSMUSP00000132604
Gene: ENSMUSG00000005575

DomainStartEndE-ValueType
UBCc 2 76 4.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210587
Predicted Effect probably benign
Transcript: ENSMUST00000211344
Predicted Effect probably benign
Transcript: ENSMUST00000211369
Predicted Effect probably benign
Transcript: ENSMUST00000211626
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is linked with a ubiquitin-like protein, NEDD8, which can be conjugated to cellular proteins, such as Cdc53/culin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Ube2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03100:Ube2m APN 7 13037635 missense probably benign 0.37
IGL03304:Ube2m APN 7 13035758 unclassified probably benign
R0077:Ube2m UTSW 7 13035730 missense probably damaging 1.00
R0715:Ube2m UTSW 7 13037626 missense probably benign 0.01
R0733:Ube2m UTSW 7 13035752 missense probably damaging 0.98
R1460:Ube2m UTSW 7 13035835 unclassified probably benign
R5207:Ube2m UTSW 7 13036322 splice site probably null
R5228:Ube2m UTSW 7 13035770 unclassified probably benign
R6226:Ube2m UTSW 7 13035888 missense probably damaging 1.00
R6299:Ube2m UTSW 7 13035870 missense probably damaging 1.00
R6591:Ube2m UTSW 7 13036469 missense probably damaging 0.99
R6594:Ube2m UTSW 7 13037690 nonsense probably null
R6691:Ube2m UTSW 7 13036469 missense probably damaging 0.99
R8036:Ube2m UTSW 7 13035639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTTGAGACTCACCTTAAAGCTG -3'
(R):5'- CCAGAAGAGTCCACGTAGAGAC -3'

Sequencing Primer
(F):5'- TGAGACTCACCTTAAAGCTGAATAC -3'
(R):5'- AGTACAGACTGAGTTAAAGTACACC -3'
Posted On2020-01-23