Incidental Mutation 'R8029:Arhgef1'
ID 617824
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene Name Rho guanine nucleotide exchange factor 1
Synonyms Lbcl2, Lsc
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.389) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 24602337-24626019 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24619163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 468 (L468P)
Ref Sequence ENSEMBL: ENSMUSP00000096280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508]
AlphaFold Q61210
Predicted Effect probably damaging
Transcript: ENSMUST00000047873
AA Change: L409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: L409P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098683
AA Change: L468P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: L468P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117419
AA Change: L409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: L409P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117796
AA Change: L465P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: L465P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132751
AA Change: L169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940
AA Change: L169P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 140 160 N/A INTRINSIC
RhoGEF 179 363 1.87e-63 SMART
PH 407 521 4.68e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205295
Predicted Effect probably damaging
Transcript: ENSMUST00000206508
AA Change: L408P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Asb3 A T 11: 31,051,180 (GRCm39) R506* probably null Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Idua T C 5: 108,817,278 (GRCm39) F17S probably benign Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nectin4 A G 1: 171,214,255 (GRCm39) D470G probably benign Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nphp1 T C 2: 127,583,036 (GRCm39) T626A probably benign Het
Nudt9 C T 5: 104,198,477 (GRCm39) probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Or7g20 T C 9: 18,947,090 (GRCm39) S224P probably damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Ppp1r9a A G 6: 5,057,518 (GRCm39) E531G possibly damaging Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Urb1 A G 16: 90,576,040 (GRCm39) S839P possibly damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24,607,784 (GRCm39) missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24,612,118 (GRCm39) missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24,625,376 (GRCm39) unclassified probably benign
IGL01479:Arhgef1 APN 7 24,612,028 (GRCm39) missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24,621,307 (GRCm39) missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24,625,208 (GRCm39) critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24,622,796 (GRCm39) missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24,611,977 (GRCm39) splice site probably benign
IGL02202:Arhgef1 APN 7 24,612,854 (GRCm39) nonsense probably null
IGL02324:Arhgef1 APN 7 24,623,240 (GRCm39) missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24,623,240 (GRCm39) missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24,623,157 (GRCm39) missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24,622,276 (GRCm39) missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24,616,268 (GRCm39) missense probably benign 0.07
BB009:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
BB019:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
R0082:Arhgef1 UTSW 7 24,612,030 (GRCm39) nonsense probably null
R0277:Arhgef1 UTSW 7 24,623,224 (GRCm39) unclassified probably benign
R0336:Arhgef1 UTSW 7 24,621,382 (GRCm39) missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24,618,785 (GRCm39) intron probably benign
R0668:Arhgef1 UTSW 7 24,607,345 (GRCm39) missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24,619,129 (GRCm39) missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24,624,423 (GRCm39) missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24,613,057 (GRCm39) missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24,607,176 (GRCm39) missense unknown
R3855:Arhgef1 UTSW 7 24,618,697 (GRCm39) missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24,618,697 (GRCm39) missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24,625,271 (GRCm39) missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24,625,271 (GRCm39) missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24,611,996 (GRCm39) missense probably benign 0.09
R4750:Arhgef1 UTSW 7 24,618,001 (GRCm39) intron probably benign
R4914:Arhgef1 UTSW 7 24,623,264 (GRCm39) missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24,624,447 (GRCm39) missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24,618,777 (GRCm39) critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24,618,777 (GRCm39) critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24,611,732 (GRCm39) splice site probably null
R5604:Arhgef1 UTSW 7 24,612,210 (GRCm39) missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24,618,782 (GRCm39) splice site probably null
R6151:Arhgef1 UTSW 7 24,617,367 (GRCm39) missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24,619,205 (GRCm39) splice site probably null
R6943:Arhgef1 UTSW 7 24,623,156 (GRCm39) missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24,616,348 (GRCm39) missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24,615,461 (GRCm39) missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24,612,003 (GRCm39) missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7932:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
R7967:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7970:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24,618,641 (GRCm39) missense probably damaging 0.99
R8132:Arhgef1 UTSW 7 24,619,174 (GRCm39) nonsense probably null
R8132:Arhgef1 UTSW 7 24,607,087 (GRCm39) intron probably benign
R8168:Arhgef1 UTSW 7 24,624,831 (GRCm39) missense probably benign 0.06
R8964:Arhgef1 UTSW 7 24,622,462 (GRCm39) missense probably damaging 1.00
R9114:Arhgef1 UTSW 7 24,607,304 (GRCm39) missense probably damaging 1.00
R9553:Arhgef1 UTSW 7 24,619,115 (GRCm39) missense probably damaging 1.00
R9676:Arhgef1 UTSW 7 24,625,501 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAATGTCAAGGCCACAGAG -3'
(R):5'- CAGTGGCACTTGGCTTACTC -3'

Sequencing Primer
(F):5'- GCCACAGAGGGCTTGTAAC -3'
(R):5'- ACTTGGCTTACTCACACTGGG -3'
Posted On 2020-01-23