Mutagenetix > Incidental Mutation

Incidental Mutation 'R8029:Arhgef1'

617824

Institutional Source

Beutler Lab

Gene Symbol

Arhgef1

Ensembl Gene

ENSMUSG00000040940

Gene Name

Rho guanine nucleotide exchange factor (GEF) 1

Synonyms

Lbcl2, Lsc

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R8029 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24902912-24926594 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24919738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 468 (L468P)

Ref Sequence

ENSEMBL: ENSMUSP00000096280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508]

AlphaFold

Q61210

Predicted Effect

probably damaging
Transcript: ENSMUST00000047873
AA Change: L409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: L409P

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098683
AA Change: L468P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: L468P

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	2.2e-78	PFAM
PDB:3ODW\|B	238	384	2e-57	PDB
low complexity region	396	412	N/A	INTRINSIC
low complexity region	439	459	N/A	INTRINSIC
RhoGEF	478	662	1.87e-63	SMART
PH	706	820	4.68e-5	SMART
low complexity region	904	923	N/A	INTRINSIC
coiled coil region	926	949	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117419
AA Change: L409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: L409P

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117796
AA Change: L465P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: L465P

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	7.3e-73	PFAM
low complexity region	393	409	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
RhoGEF	475	659	1.87e-63	SMART
PH	703	817	4.68e-5	SMART
low complexity region	901	920	N/A	INTRINSIC
coiled coil region	923	946	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000132751
AA Change: L169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940
AA Change: L169P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	70	89	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
low complexity region	140	160	N/A	INTRINSIC
RhoGEF	179	363	1.87e-63	SMART
PH	407	521	4.68e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205295

Predicted Effect

probably damaging
Transcript: ENSMUST00000206508
AA Change: L408P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,377	H543R	possibly damaging	Het
Acvr1c	A	G	2: 58,296,117	I118T	possibly damaging	Het
Alpk1	T	C	3: 127,729,285	D36G	possibly damaging	Het
Aox2	G	A	1: 58,343,668	V1036I	probably benign	Het
Armc2	A	T	10: 41,927,000	L559Q	probably damaging	Het
Asb3	A	T	11: 31,101,180	R506*	probably null	Het
Asna1	T	C	8: 85,019,827	M131V	probably benign	Het
Aspm	A	G	1: 139,471,632	H1045R	probably benign	Het
Cacna1g	G	T	11: 94,409,738	R2099S	probably benign	Het
Cd177	C	T	7: 24,756,169	W309*	probably null	Het
Cd34	A	C	1: 194,958,552	M242L	probably benign	Het
Cdh24	T	A	14: 54,639,399	N49I	probably damaging	Het
Ces2b	A	G	8: 104,834,850	N192S	probably damaging	Het
Chsy3	A	G	18: 59,179,447	I331V	possibly damaging	Het
Disp1	A	G	1: 183,089,288	S523P	probably damaging	Het
Dlgap5	T	C	14: 47,416,440	H44R	probably benign	Het
Dnajc30	G	T	5: 135,064,332	A28S	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Exd1	A	T	2: 119,528,723	H226Q	probably damaging	Het
Gata6	T	A	18: 11,054,944	V291E	possibly damaging	Het
Gfi1b	A	T	2: 28,613,675		probably null	Het
Grk3	T	A	5: 112,961,642	I150L	probably benign	Het
Gstcd	C	T	3: 133,082,107	V277M	probably damaging	Het
Idua	T	C	5: 108,669,412	F17S	probably benign	Het
Ighg1	T	C	12: 113,329,145	K268R		Het
Lama1	G	T	17: 67,817,594	R2883M		Het
Lpar3	T	C	3: 146,240,963	M132T	probably benign	Het
Macf1	T	C	4: 123,444,892	T4351A	possibly damaging	Het
March6	A	G	15: 31,496,002		probably null	Het
Mbtps1	C	A	8: 119,547,805		probably benign	Het
Mctp1	T	C	13: 77,029,886	Y931H	probably damaging	Het
Mug2	A	G	6: 122,081,545		probably null	Het
Myh1	G	T	11: 67,211,240		probably null	Het
Mylk2	T	C	2: 152,920,299	S497P	probably damaging	Het
Nectin4	A	G	1: 171,386,687	D470G	probably benign	Het
Nop2	C	T	6: 125,144,420	P722S	possibly damaging	Het
Nphp1	T	C	2: 127,741,116	T626A	probably benign	Het
Nudt9	C	T	5: 104,050,611		probably benign	Het
Olfr1145	A	G	2: 87,810,032	T71A	probably benign	Het
Olfr18	A	G	9: 20,314,347	F191S	possibly damaging	Het
Olfr512	T	A	7: 108,713,830	F159Y	possibly damaging	Het
Olfr835	T	C	9: 19,035,794	S224P	probably damaging	Het
Oplah	T	C	15: 76,305,696	Y143C	probably benign	Het
Osbpl1a	T	G	18: 12,914,521	E125D	probably benign	Het
P2ry1	C	A	3: 61,003,522	N27K	possibly damaging	Het
Palld	A	T	8: 61,877,312	I177N	probably damaging	Het
Plcl1	A	T	1: 55,696,078	I193L	probably benign	Het
Polr1a	T	A	6: 71,912,956	L53*	probably null	Het
Ppp1r9a	A	G	6: 5,057,518	E531G	possibly damaging	Het
Prex1	C	A	2: 166,575,603	Q1361H	probably benign	Het
Ptprc	T	C	1: 138,078,459	E795G	probably damaging	Het
Rars	C	T	11: 35,821,165	V295I	probably damaging	Het
Rnaseh2b	T	C	14: 62,353,548	V116A	possibly damaging	Het
Rnf43	T	A	11: 87,731,894	L480H	probably benign	Het
Rttn	A	G	18: 89,090,474	T1601A	not run	Het
Setd1a	C	G	7: 127,786,214	Q698E	probably benign	Het
Sh3gl3	T	C	7: 82,270,883	Y100H	probably benign	Het
Sis	T	C	3: 72,921,142	Y1200C	probably damaging	Het
Snx13	A	C	12: 35,119,886	H610P	probably damaging	Het
Spdl1	T	C	11: 34,822,592	R217G	probably benign	Het
Spop	G	A	11: 95,474,367	E113K	probably benign	Het
Sult2a3	G	A	7: 14,121,628	P101L	probably damaging	Het
Tbl1xr1	C	T	3: 22,200,436	H348Y	probably damaging	Het
Tmie	T	C	9: 110,867,487	T109A	possibly damaging	Het
Ttc12	A	G	9: 49,470,251	V140A	possibly damaging	Het
Ube2m	A	G	7: 13,036,597	L58P	probably damaging	Het
Urb1	A	G	16: 90,779,152	S839P	possibly damaging	Het
Vmn2r117	T	A	17: 23,477,770	D221V	probably benign	Het
Vps41	C	T	13: 18,823,785	Q263*	probably null	Het
Zfand3	A	T	17: 30,135,433	T75S	probably benign	Het
Zscan26	A	G	13: 21,445,350	C202R	probably damaging	Het

Other mutations in Arhgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Arhgef1	APN	7	24908359	missense	possibly damaging	0.93
IGL00901:Arhgef1	APN	7	24912693	missense	probably damaging	1.00
IGL01139:Arhgef1	APN	7	24925951	unclassified	probably benign
IGL01479:Arhgef1	APN	7	24912603	missense	probably benign	0.01
IGL01935:Arhgef1	APN	7	24921882	missense	probably damaging	1.00
IGL01944:Arhgef1	APN	7	24925783	critical splice acceptor site	probably null
IGL02032:Arhgef1	APN	7	24923371	missense	probably benign	0.23
IGL02059:Arhgef1	APN	7	24912552	splice site	probably benign
IGL02202:Arhgef1	APN	7	24913429	nonsense	probably null
IGL02324:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL02328:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL03027:Arhgef1	APN	7	24923732	missense	probably damaging	0.98
IGL03227:Arhgef1	APN	7	24922851	missense	probably damaging	1.00
IGL03404:Arhgef1	APN	7	24916843	missense	probably benign	0.07
BB009:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
BB019:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R0082:Arhgef1	UTSW	7	24912605	nonsense	probably null
R0277:Arhgef1	UTSW	7	24923799	unclassified	probably benign
R0336:Arhgef1	UTSW	7	24921957	missense	possibly damaging	0.77
R0494:Arhgef1	UTSW	7	24919360	intron	probably benign
R0668:Arhgef1	UTSW	7	24907920	missense	possibly damaging	0.63
R1520:Arhgef1	UTSW	7	24919704	missense	probably damaging	1.00
R1531:Arhgef1	UTSW	7	24924998	missense	probably damaging	0.99
R1656:Arhgef1	UTSW	7	24913632	missense	probably damaging	1.00
R2979:Arhgef1	UTSW	7	24907751	missense	unknown
R3855:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R3856:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R4080:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4081:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4583:Arhgef1	UTSW	7	24912571	missense	probably benign	0.09
R4750:Arhgef1	UTSW	7	24918576	intron	probably benign
R4914:Arhgef1	UTSW	7	24923839	missense	probably damaging	1.00
R5255:Arhgef1	UTSW	7	24925022	missense	probably damaging	1.00
R5275:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5295:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5430:Arhgef1	UTSW	7	24912307	splice site	probably null
R5604:Arhgef1	UTSW	7	24912785	missense	probably benign	0.09
R6150:Arhgef1	UTSW	7	24919357	splice site	probably null
R6151:Arhgef1	UTSW	7	24917942	missense	probably benign	0.00
R6788:Arhgef1	UTSW	7	24919780	splice site	probably null
R6943:Arhgef1	UTSW	7	24923731	missense	probably benign	0.01
R6988:Arhgef1	UTSW	7	24916923	missense	probably benign	0.04
R7422:Arhgef1	UTSW	7	24916036	missense	probably benign	0.00
R7701:Arhgef1	UTSW	7	24912578	missense	probably benign	0.01
R7706:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7707:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7708:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7932:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R7967:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7970:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7995:Arhgef1	UTSW	7	24919216	missense	probably damaging	0.99
R8132:Arhgef1	UTSW	7	24907662	intron	probably benign
R8132:Arhgef1	UTSW	7	24919749	nonsense	probably null
R8168:Arhgef1	UTSW	7	24925406	missense	probably benign	0.06
R8964:Arhgef1	UTSW	7	24923037	missense	probably damaging	1.00
R9114:Arhgef1	UTSW	7	24907879	missense	probably damaging	1.00
R9553:Arhgef1	UTSW	7	24919690	missense	probably damaging	1.00
R9676:Arhgef1	UTSW	7	24926076	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAAATGTCAAGGCCACAGAG -3'
(R):5'- CAGTGGCACTTGGCTTACTC -3'

Sequencing Primer
(F):5'- GCCACAGAGGGCTTGTAAC -3'
(R):5'- ACTTGGCTTACTCACACTGGG -3'

Posted On

2020-01-23