Incidental Mutation 'R8029:Arhgef1'
ID617824
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene NameRho guanine nucleotide exchange factor (GEF) 1
SynonymsLbcl2, Lsc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24902912-24926594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24919738 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 468 (L468P)
Ref Sequence ENSEMBL: ENSMUSP00000096280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508]
Predicted Effect probably damaging
Transcript: ENSMUST00000047873
AA Change: L409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: L409P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098683
AA Change: L468P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: L468P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117419
AA Change: L409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: L409P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117796
AA Change: L465P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: L465P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132751
AA Change: L169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940
AA Change: L169P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 140 160 N/A INTRINSIC
RhoGEF 179 363 1.87e-63 SMART
PH 407 521 4.68e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205295
Predicted Effect probably damaging
Transcript: ENSMUST00000206508
AA Change: L408P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24908359 missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24912693 missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24925951 unclassified probably benign
IGL01479:Arhgef1 APN 7 24912603 missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24921882 missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24925783 critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24923371 missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24912552 splice site probably benign
IGL02202:Arhgef1 APN 7 24913429 nonsense probably null
IGL02324:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24923732 missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24922851 missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24916843 missense probably benign 0.07
BB009:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
BB019:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
R0082:Arhgef1 UTSW 7 24912605 nonsense probably null
R0277:Arhgef1 UTSW 7 24923799 unclassified probably benign
R0336:Arhgef1 UTSW 7 24921957 missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24919360 intron probably benign
R0668:Arhgef1 UTSW 7 24907920 missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24919704 missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24924998 missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24913632 missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24907751 missense unknown
R3855:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24912571 missense probably benign 0.09
R4750:Arhgef1 UTSW 7 24918576 intron probably benign
R4914:Arhgef1 UTSW 7 24923839 missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24925022 missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24912307 splice site probably null
R5604:Arhgef1 UTSW 7 24912785 missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24919357 splice site probably null
R6151:Arhgef1 UTSW 7 24917942 missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24919780 splice site probably null
R6943:Arhgef1 UTSW 7 24923731 missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24916923 missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24916036 missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24912578 missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7932:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
R7967:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7970:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24919216 missense probably damaging 0.99
R8132:Arhgef1 UTSW 7 24907662 intron probably benign
R8132:Arhgef1 UTSW 7 24919749 nonsense probably null
R8168:Arhgef1 UTSW 7 24925406 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAAATGTCAAGGCCACAGAG -3'
(R):5'- CAGTGGCACTTGGCTTACTC -3'

Sequencing Primer
(F):5'- GCCACAGAGGGCTTGTAAC -3'
(R):5'- ACTTGGCTTACTCACACTGGG -3'
Posted On2020-01-23