Incidental Mutation 'R8029:Sh3gl3'
ID617825
Institutional Source Beutler Lab
Gene Symbol Sh3gl3
Ensembl Gene ENSMUSG00000030638
Gene NameSH3-domain GRB2-like 3
SynonymsEEN-B2, SH3P13, endophilin III, Sh3d2c, Sh3d2c2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location82173840-82307419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82270883 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 100 (Y100H)
Ref Sequence ENSEMBL: ENSMUSP00000032874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032874] [ENSMUST00000177883] [ENSMUST00000177895] [ENSMUST00000178526] [ENSMUST00000179318]
Predicted Effect probably benign
Transcript: ENSMUST00000032874
AA Change: Y100H

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032874
Gene: ENSMUSG00000030638
AA Change: Y100H

DomainStartEndE-ValueType
BAR 5 242 2.43e-89 SMART
SH3 288 343 5.77e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177883
SMART Domains Protein: ENSMUSP00000137207
Gene: ENSMUSG00000030638

DomainStartEndE-ValueType
Pfam:BAR 6 65 2.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177895
SMART Domains Protein: ENSMUSP00000137570
Gene: ENSMUSG00000030638

DomainStartEndE-ValueType
Pfam:BAR 6 65 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178526
SMART Domains Protein: ENSMUSP00000137482
Gene: ENSMUSG00000030638

DomainStartEndE-ValueType
Pfam:BAR 1 116 5.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179318
AA Change: Y65H

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137621
Gene: ENSMUSG00000030638
AA Change: Y65H

DomainStartEndE-ValueType
BAR 1 207 1.23e-58 SMART
SH3 253 308 5.77e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are normal and fertile. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmission and abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Sh3gl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Sh3gl3 APN 7 82285018 splice site probably benign
IGL02989:Sh3gl3 APN 7 82273879 missense probably benign 0.01
R1228:Sh3gl3 UTSW 7 82174975 start codon destroyed probably null 0.18
R1801:Sh3gl3 UTSW 7 82284119 missense possibly damaging 0.95
R2109:Sh3gl3 UTSW 7 82270800 missense possibly damaging 0.94
R5752:Sh3gl3 UTSW 7 82174948 intron probably benign
R6881:Sh3gl3 UTSW 7 82306970 missense possibly damaging 0.95
R7162:Sh3gl3 UTSW 7 82284142 missense probably benign
R7570:Sh3gl3 UTSW 7 82285077 missense probably benign
R7710:Sh3gl3 UTSW 7 82284086 missense possibly damaging 0.83
R8834:Sh3gl3 UTSW 7 82306791 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAAGCCTATGTAAAGTCACGTGAC -3'
(R):5'- GTTTCCTGAAACTCCTGCAGTG -3'

Sequencing Primer
(F):5'- TTGCATCTGTGAGGACCGC -3'
(R):5'- CCTGCAGTGAATATTACTACTCTGGG -3'
Posted On2020-01-23