Incidental Mutation 'R8029:Setd1a'
ID617827
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene NameSET domain containing 1A
SynonymsKMT2F
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8029 (G1)
Quality Score209.009
Status Not validated
Chromosome7
Chromosomal Location127776670-127800122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 127786214 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 698 (Q698E)
Ref Sequence ENSEMBL: ENSMUSP00000047672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
Predicted Effect probably benign
Transcript: ENSMUST00000047075
AA Change: Q698E

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: Q698E

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
AA Change: Q698E

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: Q698E

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
AA Change: Q155E

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127797698 unclassified probably benign
IGL02657:Setd1a APN 7 127795825 unclassified probably benign
IGL02792:Setd1a APN 7 127791350 missense unknown
IGL02876:Setd1a APN 7 127778501 splice site probably benign
IGL02967:Setd1a APN 7 127785177 unclassified probably benign
IGL03090:Setd1a APN 7 127786500 missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127785546 missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127785326 unclassified probably benign
FR4548:Setd1a UTSW 7 127785307 unclassified probably benign
FR4548:Setd1a UTSW 7 127785313 unclassified probably benign
FR4589:Setd1a UTSW 7 127785297 unclassified probably benign
FR4737:Setd1a UTSW 7 127785312 unclassified probably benign
FR4976:Setd1a UTSW 7 127785307 unclassified probably benign
FR4976:Setd1a UTSW 7 127785316 unclassified probably benign
R0367:Setd1a UTSW 7 127788186 splice site probably benign
R0411:Setd1a UTSW 7 127796051 unclassified probably benign
R0416:Setd1a UTSW 7 127785297 unclassified probably benign
R0470:Setd1a UTSW 7 127785057 unclassified probably benign
R0645:Setd1a UTSW 7 127787210 missense probably damaging 0.96
R0667:Setd1a UTSW 7 127786593 missense probably damaging 0.99
R1251:Setd1a UTSW 7 127797424 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1660:Setd1a UTSW 7 127796669 unclassified probably benign
R1730:Setd1a UTSW 7 127785124 nonsense probably null
R1760:Setd1a UTSW 7 127785890 missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127785124 nonsense probably null
R2149:Setd1a UTSW 7 127786518 missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127785489 missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127799155 unclassified probably benign
R2679:Setd1a UTSW 7 127795724 unclassified probably benign
R3428:Setd1a UTSW 7 127785321 unclassified probably benign
R4108:Setd1a UTSW 7 127799202 unclassified probably benign
R4227:Setd1a UTSW 7 127796647 unclassified probably benign
R4438:Setd1a UTSW 7 127785731 missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127797330 unclassified probably benign
R4869:Setd1a UTSW 7 127797604 unclassified probably benign
R4892:Setd1a UTSW 7 127778524 missense probably damaging 0.99
R5152:Setd1a UTSW 7 127784025 missense probably benign
R5502:Setd1a UTSW 7 127797248 critical splice donor site probably null
R5527:Setd1a UTSW 7 127785629 missense probably damaging 0.99
R6189:Setd1a UTSW 7 127778283 splice site probably null
R6250:Setd1a UTSW 7 127791299 missense unknown
R7131:Setd1a UTSW 7 127796418 small deletion probably benign
R7988:Setd1a UTSW 7 127786194 missense probably benign 0.02
R8079:Setd1a UTSW 7 127785053 missense unknown
R8171:Setd1a UTSW 7 127791227 missense unknown
R8175:Setd1a UTSW 7 127796243 missense unknown
R8286:Setd1a UTSW 7 127786184 missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127791497 missense unknown
R8460:Setd1a UTSW 7 127784120 missense unknown
R8547:Setd1a UTSW 7 127796504 unclassified probably benign
R8699:Setd1a UTSW 7 127786602 missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127786160 missense possibly damaging 0.86
RF001:Setd1a UTSW 7 127785314 unclassified probably benign
RF008:Setd1a UTSW 7 127785314 unclassified probably benign
RF011:Setd1a UTSW 7 127785343 unclassified probably benign
RF014:Setd1a UTSW 7 127785346 unclassified probably benign
RF030:Setd1a UTSW 7 127785301 unclassified probably benign
RF030:Setd1a UTSW 7 127785311 unclassified probably benign
RF031:Setd1a UTSW 7 127785311 unclassified probably benign
RF036:Setd1a UTSW 7 127785300 unclassified probably benign
RF041:Setd1a UTSW 7 127785332 unclassified probably benign
RF052:Setd1a UTSW 7 127785357 unclassified probably benign
RF055:Setd1a UTSW 7 127785299 unclassified probably benign
RF056:Setd1a UTSW 7 127785303 unclassified probably benign
RF056:Setd1a UTSW 7 127785328 unclassified probably benign
RF058:Setd1a UTSW 7 127785318 unclassified probably benign
Z1176:Setd1a UTSW 7 127799094 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGAGATCTCTGATGATGACAG -3'
(R):5'- TCTTGCCCTTGTGTGTACAG -3'

Sequencing Primer
(F):5'- TGATGACAGGGGTGGCTCAC -3'
(R):5'- CCCTTGTGTGTACAGAGCATAG -3'
Posted On2020-01-23