Incidental Mutation 'R0659:Cyp2a12'
ID 61783
Institutional Source Beutler Lab
Gene Symbol Cyp2a12
Ensembl Gene ENSMUSG00000060407
Gene Name cytochrome P450, family 2, subfamily a, polypeptide 12
Synonyms
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R0659 (G1)
Quality Score 122
Status Validated
Chromosome 7
Chromosomal Location 27029081-27037375 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27034138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 314 (L314P)
Ref Sequence ENSEMBL: ENSMUSP00000074990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075552]
AlphaFold P56593
Predicted Effect probably damaging
Transcript: ENSMUST00000075552
AA Change: L314P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074990
Gene: ENSMUSG00000060407
AA Change: L314P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.3e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207016
Meta Mutation Damage Score 0.4569 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Cyp2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Cyp2a12 APN 7 27036611 missense probably benign 0.00
IGL02306:Cyp2a12 APN 7 27032583 missense probably damaging 1.00
IGL02667:Cyp2a12 APN 7 27031158 missense probably damaging 1.00
IGL02943:Cyp2a12 APN 7 27032542 missense probably benign 0.07
IGL03025:Cyp2a12 APN 7 27031206 missense probably benign 0.00
IGL03230:Cyp2a12 APN 7 27029592 missense possibly damaging 0.48
PIT4243001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
PIT4618001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
R0655:Cyp2a12 UTSW 7 27036621 missense probably benign 0.15
R0743:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R0884:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R2118:Cyp2a12 UTSW 7 27036646 makesense probably null
R2119:Cyp2a12 UTSW 7 27036646 makesense probably null
R2120:Cyp2a12 UTSW 7 27036646 makesense probably null
R2121:Cyp2a12 UTSW 7 27036646 makesense probably null
R2122:Cyp2a12 UTSW 7 27036646 makesense probably null
R2124:Cyp2a12 UTSW 7 27036646 makesense probably null
R2144:Cyp2a12 UTSW 7 27034769 missense possibly damaging 0.95
R2153:Cyp2a12 UTSW 7 27032617 missense probably benign 0.01
R2171:Cyp2a12 UTSW 7 27029632 missense probably damaging 1.00
R2182:Cyp2a12 UTSW 7 27031146 missense probably damaging 1.00
R2297:Cyp2a12 UTSW 7 27034632 missense possibly damaging 0.92
R4392:Cyp2a12 UTSW 7 27029275 missense probably damaging 0.98
R4900:Cyp2a12 UTSW 7 27031215 nonsense probably null
R4960:Cyp2a12 UTSW 7 27034150 missense probably benign 0.11
R5111:Cyp2a12 UTSW 7 27036621 missense possibly damaging 0.89
R5143:Cyp2a12 UTSW 7 27036611 missense probably benign 0.00
R5223:Cyp2a12 UTSW 7 27036463 critical splice acceptor site probably null
R5268:Cyp2a12 UTSW 7 27031218 missense probably benign 0.00
R5493:Cyp2a12 UTSW 7 27029125 missense unknown
R5524:Cyp2a12 UTSW 7 27031231 missense probably benign 0.00
R5806:Cyp2a12 UTSW 7 27029079 splice site probably null
R6320:Cyp2a12 UTSW 7 27031152 missense possibly damaging 0.75
R6823:Cyp2a12 UTSW 7 27034156 missense possibly damaging 0.77
R7958:Cyp2a12 UTSW 7 27029252 missense probably benign 0.13
R8093:Cyp2a12 UTSW 7 27036629 missense probably damaging 0.96
R8191:Cyp2a12 UTSW 7 27031104 missense probably benign 0.00
R8259:Cyp2a12 UTSW 7 27032658 nonsense probably null
R9083:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9084:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9085:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9086:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
RF021:Cyp2a12 UTSW 7 27035360 missense possibly damaging 0.73
Z1088:Cyp2a12 UTSW 7 27035420 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAGGCTCCACACAACCTTGAGATTAC -3'
(R):5'- GCCAGTGGGAAATCAATTTGGGGATG -3'

Sequencing Primer
(F):5'- agtgggtgtggaagggg -3'
(R):5'- ACAGTTATTGAGAACTCTGTTTATGC -3'
Posted On 2013-07-30