Incidental Mutation 'R8029:Or7g20'
ID 617832
Institutional Source Beutler Lab
Gene Symbol Or7g20
Ensembl Gene ENSMUSG00000045204
Gene Name olfactory receptor family 7 subfamily G member 20
Synonyms MOR150-3, GA_x6K02T2PVTD-12771995-12772930, Olfr835
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 18946421-18947356 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18947090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 224 (S224P)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
AlphaFold Q7TRG7
Predicted Effect probably damaging
Transcript: ENSMUST00000059315
AA Change: S224P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: S224P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213018
AA Change: S224P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Arhgef1 T C 7: 24,619,163 (GRCm39) L468P probably damaging Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Asb3 A T 11: 31,051,180 (GRCm39) R506* probably null Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Idua T C 5: 108,817,278 (GRCm39) F17S probably benign Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nectin4 A G 1: 171,214,255 (GRCm39) D470G probably benign Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nphp1 T C 2: 127,583,036 (GRCm39) T626A probably benign Het
Nudt9 C T 5: 104,198,477 (GRCm39) probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Ppp1r9a A G 6: 5,057,518 (GRCm39) E531G possibly damaging Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Urb1 A G 16: 90,576,040 (GRCm39) S839P possibly damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Or7g20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Or7g20 APN 9 18,946,584 (GRCm39) nonsense probably null
IGL02546:Or7g20 APN 9 18,946,650 (GRCm39) missense possibly damaging 0.88
R0010:Or7g20 UTSW 9 18,946,618 (GRCm39) missense probably damaging 1.00
R0107:Or7g20 UTSW 9 18,946,629 (GRCm39) missense probably damaging 1.00
R1867:Or7g20 UTSW 9 18,946,562 (GRCm39) missense probably benign 0.36
R1891:Or7g20 UTSW 9 18,947,274 (GRCm39) missense probably damaging 0.99
R1941:Or7g20 UTSW 9 18,947,162 (GRCm39) missense possibly damaging 0.93
R4152:Or7g20 UTSW 9 18,946,816 (GRCm39) nonsense probably null
R5451:Or7g20 UTSW 9 18,946,787 (GRCm39) missense probably damaging 1.00
R5677:Or7g20 UTSW 9 18,946,854 (GRCm39) missense possibly damaging 0.93
R5970:Or7g20 UTSW 9 18,946,443 (GRCm39) missense probably benign
R6187:Or7g20 UTSW 9 18,946,689 (GRCm39) missense probably benign 0.12
R6805:Or7g20 UTSW 9 18,946,597 (GRCm39) missense probably damaging 1.00
R7183:Or7g20 UTSW 9 18,946,628 (GRCm39) missense probably damaging 1.00
R8139:Or7g20 UTSW 9 18,946,871 (GRCm39) missense probably benign 0.07
R8736:Or7g20 UTSW 9 18,946,774 (GRCm39) missense probably damaging 1.00
R8868:Or7g20 UTSW 9 18,946,778 (GRCm39) missense probably damaging 1.00
R8909:Or7g20 UTSW 9 18,946,888 (GRCm39) missense probably benign 0.08
R9116:Or7g20 UTSW 9 18,946,773 (GRCm39) missense probably damaging 1.00
R9479:Or7g20 UTSW 9 18,946,730 (GRCm39) missense probably benign 0.30
R9786:Or7g20 UTSW 9 18,947,241 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAACATGGGACTTCTTGGTCTC -3'
(R):5'- TGGGTTCAACATTTGTGGGACTAC -3'

Sequencing Primer
(F):5'- CTTCTTGGTCTCATGGTATTAAGAC -3'
(R):5'- TACAGTGTACATAATGCAGGCC -3'
Posted On 2020-01-23