Incidental Mutation 'R8029:Asb3'
ID 617837
Institutional Source Beutler Lab
Gene Symbol Asb3
Ensembl Gene ENSMUSG00000020305
Gene Name ankyrin repeat and SOCS box-containing 3
Synonyms 2400011J03Rik
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.428) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 30904398-31052704 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 31051180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 506 (R506*)
Ref Sequence ENSEMBL: ENSMUSP00000020551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000137306] [ENSMUST00000203878]
AlphaFold Q9WV72
Predicted Effect probably null
Transcript: ENSMUST00000020551
AA Change: R506*
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305
AA Change: R506*

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203878
AA Change: R545*
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305
AA Change: R545*

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Arhgef1 T C 7: 24,619,163 (GRCm39) L468P probably damaging Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Idua T C 5: 108,817,278 (GRCm39) F17S probably benign Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nectin4 A G 1: 171,214,255 (GRCm39) D470G probably benign Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nphp1 T C 2: 127,583,036 (GRCm39) T626A probably benign Het
Nudt9 C T 5: 104,198,477 (GRCm39) probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Or7g20 T C 9: 18,947,090 (GRCm39) S224P probably damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Ppp1r9a A G 6: 5,057,518 (GRCm39) E531G possibly damaging Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Urb1 A G 16: 90,576,040 (GRCm39) S839P possibly damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Asb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02879:Asb3 APN 11 31,051,067 (GRCm39) missense probably damaging 1.00
IGL02932:Asb3 APN 11 30,979,067 (GRCm39) critical splice donor site probably null
Kickbox UTSW 11 30,948,326 (GRCm39) missense probably damaging 1.00
low_blow UTSW 11 30,948,348 (GRCm39) nonsense probably null
Octagon UTSW 11 30,948,321 (GRCm39) missense probably benign 0.34
penalty UTSW 11 31,031,357 (GRCm39) splice site probably null
sixpack UTSW 11 31,035,143 (GRCm39) missense probably benign
R0573:Asb3 UTSW 11 31,011,406 (GRCm39) missense probably damaging 0.99
R1395:Asb3 UTSW 11 31,051,032 (GRCm39) splice site probably benign
R1545:Asb3 UTSW 11 31,006,217 (GRCm39) missense probably benign 0.00
R2108:Asb3 UTSW 11 31,031,355 (GRCm39) splice site probably null
R2364:Asb3 UTSW 11 31,051,192 (GRCm39) missense probably benign 0.01
R4527:Asb3 UTSW 11 31,008,933 (GRCm39) missense probably benign 0.30
R5019:Asb3 UTSW 11 31,031,415 (GRCm39) missense possibly damaging 0.95
R5176:Asb3 UTSW 11 31,031,357 (GRCm39) splice site probably null
R5344:Asb3 UTSW 11 31,051,114 (GRCm39) missense probably benign 0.01
R5734:Asb3 UTSW 11 30,979,021 (GRCm39) missense probably damaging 1.00
R6251:Asb3 UTSW 11 31,005,559 (GRCm39) missense probably damaging 1.00
R6265:Asb3 UTSW 11 31,035,143 (GRCm39) missense probably benign
R6747:Asb3 UTSW 11 31,031,493 (GRCm39) missense probably benign 0.01
R6827:Asb3 UTSW 11 31,051,211 (GRCm39) missense probably benign 0.00
R6928:Asb3 UTSW 11 30,948,326 (GRCm39) missense probably damaging 1.00
R7048:Asb3 UTSW 11 31,051,121 (GRCm39) missense probably damaging 1.00
R7087:Asb3 UTSW 11 30,948,321 (GRCm39) missense probably benign 0.34
R7135:Asb3 UTSW 11 30,948,501 (GRCm39) nonsense probably null
R7165:Asb3 UTSW 11 30,979,029 (GRCm39) missense probably damaging 0.99
R7200:Asb3 UTSW 11 30,948,348 (GRCm39) nonsense probably null
R7265:Asb3 UTSW 11 30,948,495 (GRCm39) missense probably benign 0.02
R7509:Asb3 UTSW 11 30,948,507 (GRCm39) missense probably benign 0.12
R7674:Asb3 UTSW 11 31,031,435 (GRCm39) missense possibly damaging 0.92
R8034:Asb3 UTSW 11 31,031,554 (GRCm39) nonsense probably null
R8061:Asb3 UTSW 11 30,948,447 (GRCm39) missense probably damaging 1.00
R8724:Asb3 UTSW 11 31,051,120 (GRCm39) missense probably damaging 1.00
R8952:Asb3 UTSW 11 31,008,959 (GRCm39) missense probably damaging 1.00
R9310:Asb3 UTSW 11 30,978,962 (GRCm39) missense probably benign 0.34
R9381:Asb3 UTSW 11 31,051,088 (GRCm39) missense probably damaging 1.00
R9708:Asb3 UTSW 11 31,051,075 (GRCm39) missense probably benign 0.03
R9711:Asb3 UTSW 11 31,031,400 (GRCm39) missense probably damaging 1.00
R9716:Asb3 UTSW 11 31,031,460 (GRCm39) missense probably benign 0.03
R9747:Asb3 UTSW 11 31,008,946 (GRCm39) missense possibly damaging 0.69
RF016:Asb3 UTSW 11 31,011,407 (GRCm39) missense possibly damaging 0.95
X0024:Asb3 UTSW 11 31,008,950 (GRCm39) missense probably damaging 0.97
Z1177:Asb3 UTSW 11 31,008,965 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCCTTGATACAGGGTCTCTC -3'
(R):5'- GATGGATAAGGTTCACAATATTGGG -3'

Sequencing Primer
(F):5'- GAAGTTCAAACTCAGGTCGTCATGC -3'
(R):5'- CACAATATTGGGAAAGACACAAACTG -3'
Posted On 2020-01-23