Incidental Mutation 'R8029:Asb3'
ID617837
Institutional Source Beutler Lab
Gene Symbol Asb3
Ensembl Gene ENSMUSG00000020305
Gene Nameankyrin repeat and SOCS box-containing 3
Synonyms2400011J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location30885416-31102704 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 31101180 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 506 (R506*)
Ref Sequence ENSEMBL: ENSMUSP00000020551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably null
Transcript: ENSMUST00000020551
AA Change: R506*
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305
AA Change: R506*

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203878
AA Change: R545*
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305
AA Change: R545*

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Asb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02879:Asb3 APN 11 31101067 missense probably damaging 1.00
IGL02932:Asb3 APN 11 31029067 critical splice donor site probably null
Kickbox UTSW 11 30998326 missense probably damaging 1.00
low_blow UTSW 11 30998348 nonsense probably null
Octagon UTSW 11 30998321 missense probably benign 0.34
penalty UTSW 11 31081357 splice site probably null
sixpack UTSW 11 31085143 missense probably benign
R0573:Asb3 UTSW 11 31061406 missense probably damaging 0.99
R1395:Asb3 UTSW 11 31101032 splice site probably benign
R1545:Asb3 UTSW 11 31056217 missense probably benign 0.00
R2108:Asb3 UTSW 11 31081355 splice site probably null
R2364:Asb3 UTSW 11 31101192 missense probably benign 0.01
R4527:Asb3 UTSW 11 31058933 missense probably benign 0.30
R5019:Asb3 UTSW 11 31081415 missense possibly damaging 0.95
R5176:Asb3 UTSW 11 31081357 splice site probably null
R5344:Asb3 UTSW 11 31101114 missense probably benign 0.01
R5734:Asb3 UTSW 11 31029021 missense probably damaging 1.00
R6251:Asb3 UTSW 11 31055559 missense probably damaging 1.00
R6265:Asb3 UTSW 11 31085143 missense probably benign
R6747:Asb3 UTSW 11 31081493 missense probably benign 0.01
R6827:Asb3 UTSW 11 31101211 missense probably benign 0.00
R6928:Asb3 UTSW 11 30998326 missense probably damaging 1.00
R7048:Asb3 UTSW 11 31101121 missense probably damaging 1.00
R7087:Asb3 UTSW 11 30998321 missense probably benign 0.34
R7135:Asb3 UTSW 11 30998501 nonsense probably null
R7165:Asb3 UTSW 11 31029029 missense probably damaging 0.99
R7200:Asb3 UTSW 11 30998348 nonsense probably null
R7265:Asb3 UTSW 11 30998495 missense probably benign 0.02
R7509:Asb3 UTSW 11 30998507 missense probably benign 0.12
R7674:Asb3 UTSW 11 31081435 missense possibly damaging 0.92
R8034:Asb3 UTSW 11 31081554 nonsense probably null
R8061:Asb3 UTSW 11 30998447 missense probably damaging 1.00
R8724:Asb3 UTSW 11 31101120 missense probably damaging 1.00
RF016:Asb3 UTSW 11 31061407 missense possibly damaging 0.95
X0024:Asb3 UTSW 11 31058950 missense probably damaging 0.97
Z1177:Asb3 UTSW 11 31058965 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCCTTGATACAGGGTCTCTC -3'
(R):5'- GATGGATAAGGTTCACAATATTGGG -3'

Sequencing Primer
(F):5'- GAAGTTCAAACTCAGGTCGTCATGC -3'
(R):5'- CACAATATTGGGAAAGACACAAACTG -3'
Posted On2020-01-23