Mutagenetix > Incidental Mutations

Incidental Mutation 'R8029:Rars'

617839

Institutional Source

Beutler Lab

Gene Symbol

Rars

Ensembl Gene

ENSMUSG00000018848

Gene Name

arginyl-tRNA synthetase

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R8029 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

35808381-35834506 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 35821165 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 295 (V295I)

Ref Sequence

ENSEMBL: ENSMUSP00000018992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018992]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018992
AA Change: V295I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018992
Gene: ENSMUSG00000018848
AA Change: V295I

Domain	Start	End	E-Value	Type
Blast:Arg_tRNA_synt_N	16	60	6e-13	BLAST
Arg_tRNA_synt_N	78	166	1.6e-27	SMART
Pfam:tRNA-synt_1d	174	520	1.2e-164	PFAM
DALR_1	534	660	3.12e-30	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,377	H543R	possibly damaging	Het
Acvr1c	A	G	2: 58,296,117	I118T	possibly damaging	Het
Alpk1	T	C	3: 127,729,285	D36G	possibly damaging	Het
Aox2	G	A	1: 58,343,668	V1036I	probably benign	Het
Arhgef1	T	C	7: 24,919,738	L468P	probably damaging	Het
Armc2	A	T	10: 41,927,000	L559Q	probably damaging	Het
Asb3	A	T	11: 31,101,180	R506*	probably null	Het
Asna1	T	C	8: 85,019,827	M131V	probably benign	Het
Aspm	A	G	1: 139,471,632	H1045R	probably benign	Het
Cacna1g	G	T	11: 94,409,738	R2099S	probably benign	Het
Cd177	C	T	7: 24,756,169	W309*	probably null	Het
Cd34	A	C	1: 194,958,552	M242L	probably benign	Het
Cdh24	T	A	14: 54,639,399	N49I	probably damaging	Het
Ces2b	A	G	8: 104,834,850	N192S	probably damaging	Het
Chsy3	A	G	18: 59,179,447	I331V	possibly damaging	Het
Disp1	A	G	1: 183,089,288	S523P	probably damaging	Het
Dlgap5	T	C	14: 47,416,440	H44R	probably benign	Het
Dnajc30	G	T	5: 135,064,332	A28S	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Exd1	A	T	2: 119,528,723	H226Q	probably damaging	Het
Gata6	T	A	18: 11,054,944	V291E	possibly damaging	Het
Gfi1b	A	T	2: 28,613,675		probably null	Het
Grk3	T	A	5: 112,961,642	I150L	probably benign	Het
Gstcd	C	T	3: 133,082,107	V277M	probably damaging	Het
Idua	T	C	5: 108,669,412	F17S	probably benign	Het
Ighg1	T	C	12: 113,329,145	K268R		Het
Lama1	G	T	17: 67,817,594	R2883M		Het
Lpar3	T	C	3: 146,240,963	M132T	probably benign	Het
Macf1	T	C	4: 123,444,892	T4351A	possibly damaging	Het
March6	A	G	15: 31,496,002		probably null	Het
Mbtps1	C	A	8: 119,547,805		probably benign	Het
Mctp1	T	C	13: 77,029,886	Y931H	probably damaging	Het
Mug2	A	G	6: 122,081,545		probably null	Het
Myh1	G	T	11: 67,211,240		probably null	Het
Mylk2	T	C	2: 152,920,299	S497P	probably damaging	Het
Nectin4	A	G	1: 171,386,687	D470G	probably benign	Het
Nop2	C	T	6: 125,144,420	P722S	possibly damaging	Het
Nphp1	T	C	2: 127,741,116	T626A	probably benign	Het
Nudt9	C	T	5: 104,050,611		probably benign	Het
Olfr1145	A	G	2: 87,810,032	T71A	probably benign	Het
Olfr18	A	G	9: 20,314,347	F191S	possibly damaging	Het
Olfr512	T	A	7: 108,713,830	F159Y	possibly damaging	Het
Olfr835	T	C	9: 19,035,794	S224P	probably damaging	Het
Oplah	T	C	15: 76,305,696	Y143C	probably benign	Het
Osbpl1a	T	G	18: 12,914,521	E125D	probably benign	Het
P2ry1	C	A	3: 61,003,522	N27K	possibly damaging	Het
Palld	A	T	8: 61,877,312	I177N	probably damaging	Het
Plcl1	A	T	1: 55,696,078	I193L	probably benign	Het
Polr1a	T	A	6: 71,912,956	L53*	probably null	Het
Ppp1r9a	A	G	6: 5,057,518	E531G	possibly damaging	Het
Prex1	C	A	2: 166,575,603	Q1361H	probably benign	Het
Ptprc	T	C	1: 138,078,459	E795G	probably damaging	Het
Rnaseh2b	T	C	14: 62,353,548	V116A	possibly damaging	Het
Rnf43	T	A	11: 87,731,894	L480H	probably benign	Het
Rttn	A	G	18: 89,090,474	T1601A	not run	Het
Setd1a	C	G	7: 127,786,214	Q698E	probably benign	Het
Sh3gl3	T	C	7: 82,270,883	Y100H	probably benign	Het
Sis	T	C	3: 72,921,142	Y1200C	probably damaging	Het
Snx13	A	C	12: 35,119,886	H610P	probably damaging	Het
Spdl1	T	C	11: 34,822,592	R217G	probably benign	Het
Spop	G	A	11: 95,474,367	E113K	probably benign	Het
Sult2a3	G	A	7: 14,121,628	P101L	probably damaging	Het
Tbl1xr1	C	T	3: 22,200,436	H348Y	probably damaging	Het
Tmie	T	C	9: 110,867,487	T109A	possibly damaging	Het
Ttc12	A	G	9: 49,470,251	V140A	possibly damaging	Het
Ube2m	A	G	7: 13,036,597	L58P	probably damaging	Het
Urb1	A	G	16: 90,779,152	S839P	possibly damaging	Het
Vmn2r117	T	A	17: 23,477,770	D221V	probably benign	Het
Vps41	C	T	13: 18,823,785	Q263*	probably null	Het
Zfand3	A	T	17: 30,135,433	T75S	probably benign	Het
Zscan26	A	G	13: 21,445,350	C202R	probably damaging	Het

Other mutations in Rars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01568:Rars	APN	11	35825981	splice site	probably benign
IGL01672:Rars	APN	11	35808553	missense	probably damaging	0.99
IGL01721:Rars	APN	11	35828664	missense	probably damaging	1.00
IGL01887:Rars	APN	11	35825995	missense	probably benign	0.03
IGL02605:Rars	APN	11	35824526	splice site	probably benign
IGL03296:Rars	APN	11	35816696	nonsense	probably null
IGL03354:Rars	APN	11	35824475	missense	probably damaging	1.00
R0410:Rars	UTSW	11	35826020	missense	probably damaging	1.00
R1193:Rars	UTSW	11	35809326	missense	possibly damaging	0.92
R1222:Rars	UTSW	11	35809740	missense	probably damaging	1.00
R1418:Rars	UTSW	11	35809740	missense	probably damaging	1.00
R1562:Rars	UTSW	11	35821094	critical splice donor site	probably null
R1768:Rars	UTSW	11	35809638	missense	probably damaging	1.00
R1800:Rars	UTSW	11	35825995	missense	probably benign	0.03
R2055:Rars	UTSW	11	35826583	splice site	probably benign
R2294:Rars	UTSW	11	35817536	splice site	probably benign
R4281:Rars	UTSW	11	35821224	missense	probably damaging	1.00
R4807:Rars	UTSW	11	35809146	missense	possibly damaging	0.81
R4898:Rars	UTSW	11	35808558	missense	probably damaging	1.00
R5522:Rars	UTSW	11	35817368	nonsense	probably null
R5907:Rars	UTSW	11	35828648	missense	probably damaging	1.00
R6243:Rars	UTSW	11	35826547	missense	possibly damaging	0.64
R6289:Rars	UTSW	11	35826067	missense	probably damaging	1.00
R6550:Rars	UTSW	11	35833183	missense	probably benign	0.00
R6889:Rars	UTSW	11	35808486	missense	probably damaging	1.00
R7260:Rars	UTSW	11	35834454	missense	probably benign	0.00
R7682:Rars	UTSW	11	35828752	missense	probably benign	0.00
R7808:Rars	UTSW	11	35828707	missense	probably benign
R7822:Rars	UTSW	11	35819966	missense	probably damaging	0.99
R7856:Rars	UTSW	11	35808585	missense	probably benign	0.09
Z1177:Rars	UTSW	11	35826109	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCATGTGGCAAATGCATTCC -3'
(R):5'- AACTTGAACAGTGTTCTTGGCTTTG -3'

Sequencing Primer
(F):5'- GGCAAATGCATTCCTTTATTTACACC -3'
(R):5'- AACAGTGTTCTTGGCTTTGGAGTAG -3'

Posted On

2020-01-23