Incidental Mutation 'R8029:Rnf43'
ID617841
Institutional Source Beutler Lab
Gene Symbol Rnf43
Ensembl Gene ENSMUSG00000034177
Gene Namering finger protein 43
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87662722-87735539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87731894 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 480 (L480H)
Ref Sequence ENSEMBL: ENSMUSP00000044241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040089] [ENSMUST00000092800] [ENSMUST00000121782] [ENSMUST00000165679]
Predicted Effect probably benign
Transcript: ENSMUST00000040089
AA Change: L480H

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044241
Gene: ENSMUSG00000034177
AA Change: L480H

DomainStartEndE-ValueType
PDB:4KNG|F 1 71 7e-32 PDB
transmembrane domain 72 91 N/A INTRINSIC
RING 145 185 6.43e-8 SMART
low complexity region 337 351 N/A INTRINSIC
low complexity region 366 376 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
low complexity region 646 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092800
AA Change: L607H

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090476
Gene: ENSMUSG00000034177
AA Change: L607H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121782
AA Change: L566H

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112748
Gene: ENSMUSG00000034177
AA Change: L566H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 157 6e-54 PDB
transmembrane domain 158 177 N/A INTRINSIC
RING 231 271 6.43e-8 SMART
low complexity region 423 437 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 577 602 N/A INTRINSIC
low complexity region 732 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165679
AA Change: L607H

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130685
Gene: ENSMUSG00000034177
AA Change: L607H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RING-type E3 ubiquitin ligase and is predicted to contain a transmembrane domain, a protease-associated domain, an ectodomain, and a cytoplasmic RING domain. This protein is thought to negatively regulate Wnt signaling, and expression of this gene results in an increase in ubiquitination of frizzled receptors, an alteration in their subcellular distribution, resulting in reduced surface levels of these receptors. Mutations in this gene have been reported in multiple tumor cells, including colorectal and endometrial cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Rnf43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Rnf43 APN 11 87731892 missense probably benign 0.15
IGL01520:Rnf43 APN 11 87664716 missense probably damaging 1.00
IGL01541:Rnf43 APN 11 87730220 missense probably null 1.00
IGL01784:Rnf43 APN 11 87731806 missense possibly damaging 0.56
IGL02037:Rnf43 APN 11 87731653 missense probably benign 0.00
IGL02725:Rnf43 APN 11 87731585 missense probably damaging 1.00
IGL03062:Rnf43 APN 11 87732304 nonsense probably null
R0226:Rnf43 UTSW 11 87731437 missense probably damaging 1.00
R0391:Rnf43 UTSW 11 87731282 missense possibly damaging 0.86
R0834:Rnf43 UTSW 11 87731251 missense probably benign
R1163:Rnf43 UTSW 11 87729513 missense probably damaging 0.98
R1203:Rnf43 UTSW 11 87727475 splice site probably benign
R1314:Rnf43 UTSW 11 87732319 missense probably benign
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1511:Rnf43 UTSW 11 87731347 missense probably benign 0.00
R1513:Rnf43 UTSW 11 87729431 missense probably damaging 1.00
R1614:Rnf43 UTSW 11 87731659 nonsense probably null
R1615:Rnf43 UTSW 11 87731659 nonsense probably null
R2341:Rnf43 UTSW 11 87732025 missense probably damaging 0.96
R2410:Rnf43 UTSW 11 87732259 missense possibly damaging 0.94
R2847:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R2849:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R5567:Rnf43 UTSW 11 87727445 missense probably damaging 1.00
R5943:Rnf43 UTSW 11 87731735 missense probably damaging 1.00
R6135:Rnf43 UTSW 11 87732125 missense probably damaging 1.00
R6452:Rnf43 UTSW 11 87732253 missense probably damaging 1.00
R6511:Rnf43 UTSW 11 87732163 missense probably benign 0.01
R7426:Rnf43 UTSW 11 87731852 missense probably benign 0.03
R7528:Rnf43 UTSW 11 87732128 missense probably benign 0.00
R8167:Rnf43 UTSW 11 87727406 missense probably benign 0.03
R8174:Rnf43 UTSW 11 87731231 missense probably benign 0.39
R8498:Rnf43 UTSW 11 87727441 missense probably damaging 1.00
R8905:Rnf43 UTSW 11 87731125 missense probably damaging 1.00
X0064:Rnf43 UTSW 11 87727342 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGTTTCCAGCCACATACACTATCAC -3'
(R):5'- AGTGTGCACAGTCAAGTCCG -3'

Sequencing Primer
(F):5'- TACACTATCACCGGCACCG -3'
(R):5'- TCAAGTCCGGGGGCAGAG -3'
Posted On2020-01-23