Incidental Mutation 'R8029:March6'
ID617853
Institutional Source Beutler Lab
Gene Symbol March6
Ensembl Gene ENSMUSG00000039100
Gene Namemembrane-associated ring finger (C3HC4) 6
SynonymsF830029L24Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location31455891-31531053 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 31496002 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090227]
Predicted Effect probably null
Transcript: ENSMUST00000090227
SMART Domains Protein: ENSMUSP00000087694
Gene: ENSMUSG00000039100

DomainStartEndE-ValueType
RINGv 8 56 1.13e-21 SMART
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
low complexity region 223 259 N/A INTRINSIC
transmembrane domain 290 312 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 522 540 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
transmembrane domain 805 827 N/A INTRINSIC
transmembrane domain 847 866 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated E3 ubiquitin ligases containing RING-CH-type zinc finger motifs. Ubiquitination of type II deiodinase by the encoded protein is an important regulatory step in thyroid hormone signalling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in March6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:March6 APN 15 31475763 missense probably benign 0.00
IGL00902:March6 APN 15 31484978 missense probably damaging 1.00
IGL02352:March6 APN 15 31509759 missense probably damaging 1.00
IGL02359:March6 APN 15 31509759 missense probably damaging 1.00
IGL02565:March6 APN 15 31490566 splice site probably benign
IGL02735:March6 APN 15 31486120 missense probably benign 0.00
IGL02808:March6 APN 15 31478406 missense probably benign 0.32
IGL03122:March6 APN 15 31478293 critical splice donor site probably null
IGL03235:March6 APN 15 31485995 missense probably damaging 1.00
IGL03238:March6 APN 15 31461941 critical splice donor site probably benign
IGL03263:March6 APN 15 31486362 missense probably benign 0.01
R0003:March6 UTSW 15 31469532 splice site probably benign
R0056:March6 UTSW 15 31467734 missense possibly damaging 0.68
R0115:March6 UTSW 15 31475812 missense probably benign
R0126:March6 UTSW 15 31462005 missense probably benign 0.00
R0148:March6 UTSW 15 31490612 missense probably damaging 0.99
R0744:March6 UTSW 15 31480291 missense probably benign 0.00
R0833:March6 UTSW 15 31480291 missense probably benign 0.00
R1205:March6 UTSW 15 31469673 missense probably benign 0.01
R1339:March6 UTSW 15 31486402 missense probably benign 0.12
R1485:March6 UTSW 15 31498693 missense probably damaging 0.96
R1885:March6 UTSW 15 31502806 missense probably benign 0.00
R1889:March6 UTSW 15 31459193 missense possibly damaging 0.86
R1984:March6 UTSW 15 31469646 missense probably damaging 0.99
R2007:March6 UTSW 15 31461941 critical splice donor site probably null
R2046:March6 UTSW 15 31486434 missense probably benign 0.01
R2135:March6 UTSW 15 31509764 nonsense probably null
R3116:March6 UTSW 15 31486119 missense probably benign 0.00
R3710:March6 UTSW 15 31509826 splice site probably benign
R3715:March6 UTSW 15 31465259 missense probably benign 0.00
R3749:March6 UTSW 15 31462014 missense probably benign 0.00
R3944:March6 UTSW 15 31488814 missense probably benign 0.00
R4327:March6 UTSW 15 31498741 missense probably benign 0.17
R4329:March6 UTSW 15 31498741 missense probably benign 0.17
R5001:March6 UTSW 15 31465322 missense probably damaging 0.98
R5149:March6 UTSW 15 31461994 missense possibly damaging 0.53
R5654:March6 UTSW 15 31485936 missense probably damaging 1.00
R6163:March6 UTSW 15 31465351 missense probably benign
R6172:March6 UTSW 15 31482867 missense possibly damaging 0.86
R6381:March6 UTSW 15 31467692 missense probably benign 0.01
R6888:March6 UTSW 15 31459233 missense probably benign 0.00
R7347:March6 UTSW 15 31486359 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTTCCCTCTTTCACAGAAAGC -3'
(R):5'- AAGTGAATTCCTGGGCTTTTCTC -3'

Sequencing Primer
(F):5'- TCCCTCTTTCACAGAAAGCAACTTAC -3'
(R):5'- CCTGTAGGAGGAAATGGTGC -3'
Posted On2020-01-23