Incidental Mutation 'R8029:Urb1'
ID 617855
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene Name URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms 5730405K23Rik, 4921511H13Rik
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 90548415-90607301 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90576040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 839 (S839P)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000140920
AA Change: S839P

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: S839P

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Arhgef1 T C 7: 24,619,163 (GRCm39) L468P probably damaging Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Asb3 A T 11: 31,051,180 (GRCm39) R506* probably null Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Idua T C 5: 108,817,278 (GRCm39) F17S probably benign Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nectin4 A G 1: 171,214,255 (GRCm39) D470G probably benign Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nphp1 T C 2: 127,583,036 (GRCm39) T626A probably benign Het
Nudt9 C T 5: 104,198,477 (GRCm39) probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Or7g20 T C 9: 18,947,090 (GRCm39) S224P probably damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Ppp1r9a A G 6: 5,057,518 (GRCm39) E531G possibly damaging Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90,550,209 (GRCm39) critical splice donor site probably null
IGL00915:Urb1 APN 16 90,575,986 (GRCm39) missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90,589,702 (GRCm39) missense probably damaging 1.00
IGL01122:Urb1 APN 16 90,601,346 (GRCm39) missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90,554,649 (GRCm39) missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90,574,448 (GRCm39) missense probably benign 0.11
IGL01606:Urb1 APN 16 90,557,347 (GRCm39) missense probably damaging 1.00
IGL01989:Urb1 APN 16 90,566,474 (GRCm39) splice site probably benign
IGL02516:Urb1 APN 16 90,569,583 (GRCm39) missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90,585,044 (GRCm39) missense probably benign 0.02
IGL03165:Urb1 APN 16 90,577,192 (GRCm39) missense probably damaging 1.00
IGL03216:Urb1 APN 16 90,585,002 (GRCm39) missense probably benign 0.00
H8562:Urb1 UTSW 16 90,566,357 (GRCm39) missense probably benign 0.08
H8786:Urb1 UTSW 16 90,566,357 (GRCm39) missense probably benign 0.08
R0064:Urb1 UTSW 16 90,576,028 (GRCm39) missense probably benign
R0064:Urb1 UTSW 16 90,576,028 (GRCm39) missense probably benign
R0359:Urb1 UTSW 16 90,588,048 (GRCm39) missense probably damaging 1.00
R0386:Urb1 UTSW 16 90,593,287 (GRCm39) missense probably damaging 1.00
R0508:Urb1 UTSW 16 90,580,150 (GRCm39) splice site probably benign
R0517:Urb1 UTSW 16 90,574,310 (GRCm39) nonsense probably null
R0704:Urb1 UTSW 16 90,573,095 (GRCm39) missense probably benign 0.31
R0755:Urb1 UTSW 16 90,576,026 (GRCm39) missense probably benign
R0755:Urb1 UTSW 16 90,570,982 (GRCm39) missense probably damaging 1.00
R0783:Urb1 UTSW 16 90,607,185 (GRCm39) missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90,592,336 (GRCm39) missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90,592,336 (GRCm39) missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90,566,335 (GRCm39) missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90,573,206 (GRCm39) splice site probably null
R1344:Urb1 UTSW 16 90,566,354 (GRCm39) missense probably damaging 1.00
R1418:Urb1 UTSW 16 90,566,354 (GRCm39) missense probably damaging 1.00
R1453:Urb1 UTSW 16 90,593,380 (GRCm39) missense probably damaging 1.00
R1470:Urb1 UTSW 16 90,548,902 (GRCm39) missense probably benign 0.34
R1470:Urb1 UTSW 16 90,548,902 (GRCm39) missense probably benign 0.34
R1520:Urb1 UTSW 16 90,571,633 (GRCm39) missense probably benign 0.00
R1521:Urb1 UTSW 16 90,550,751 (GRCm39) missense probably damaging 1.00
R1598:Urb1 UTSW 16 90,574,328 (GRCm39) missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90,557,340 (GRCm39) missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90,570,936 (GRCm39) critical splice donor site probably null
R1640:Urb1 UTSW 16 90,569,514 (GRCm39) missense probably benign 0.00
R1664:Urb1 UTSW 16 90,584,970 (GRCm39) critical splice donor site probably null
R1672:Urb1 UTSW 16 90,584,285 (GRCm39) missense probably damaging 1.00
R1694:Urb1 UTSW 16 90,563,928 (GRCm39) missense probably benign
R1856:Urb1 UTSW 16 90,558,583 (GRCm39) missense probably benign 0.00
R2001:Urb1 UTSW 16 90,559,232 (GRCm39) missense probably benign 0.30
R2196:Urb1 UTSW 16 90,571,144 (GRCm39) missense probably benign 0.01
R2850:Urb1 UTSW 16 90,571,144 (GRCm39) missense probably benign 0.01
R3009:Urb1 UTSW 16 90,571,686 (GRCm39) missense probably benign 0.09
R3104:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3105:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3106:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3160:Urb1 UTSW 16 90,594,791 (GRCm39) missense probably damaging 1.00
R3162:Urb1 UTSW 16 90,594,791 (GRCm39) missense probably damaging 1.00
R3900:Urb1 UTSW 16 90,580,264 (GRCm39) missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90,566,353 (GRCm39) missense probably damaging 1.00
R4036:Urb1 UTSW 16 90,584,974 (GRCm39) missense probably benign
R4332:Urb1 UTSW 16 90,571,425 (GRCm39) missense probably damaging 1.00
R4448:Urb1 UTSW 16 90,566,282 (GRCm39) missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90,585,034 (GRCm39) missense probably benign 0.04
R4593:Urb1 UTSW 16 90,584,332 (GRCm39) missense probably damaging 1.00
R4610:Urb1 UTSW 16 90,573,159 (GRCm39) missense probably benign 0.43
R4659:Urb1 UTSW 16 90,573,017 (GRCm39) missense probably damaging 0.96
R4672:Urb1 UTSW 16 90,569,522 (GRCm39) missense probably benign
R4681:Urb1 UTSW 16 90,601,425 (GRCm39) missense probably damaging 0.99
R4771:Urb1 UTSW 16 90,550,406 (GRCm39) missense probably benign 0.00
R4790:Urb1 UTSW 16 90,566,443 (GRCm39) nonsense probably null
R4798:Urb1 UTSW 16 90,554,715 (GRCm39) missense probably benign 0.12
R4809:Urb1 UTSW 16 90,556,730 (GRCm39) missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90,592,302 (GRCm39) nonsense probably null
R4916:Urb1 UTSW 16 90,580,216 (GRCm39) missense probably damaging 1.00
R4969:Urb1 UTSW 16 90,602,299 (GRCm39) missense probably damaging 1.00
R5032:Urb1 UTSW 16 90,553,059 (GRCm39) missense probably benign 0.00
R5111:Urb1 UTSW 16 90,548,905 (GRCm39) missense probably benign 0.00
R5122:Urb1 UTSW 16 90,548,983 (GRCm39) nonsense probably null
R5184:Urb1 UTSW 16 90,580,162 (GRCm39) critical splice donor site probably null
R5199:Urb1 UTSW 16 90,589,636 (GRCm39) missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90,589,650 (GRCm39) missense probably damaging 1.00
R5767:Urb1 UTSW 16 90,573,051 (GRCm39) missense probably benign 0.00
R5812:Urb1 UTSW 16 90,601,425 (GRCm39) missense probably damaging 0.99
R5872:Urb1 UTSW 16 90,569,652 (GRCm39) nonsense probably null
R6052:Urb1 UTSW 16 90,559,271 (GRCm39) missense probably damaging 1.00
R6063:Urb1 UTSW 16 90,585,985 (GRCm39) missense probably benign 0.02
R6065:Urb1 UTSW 16 90,600,220 (GRCm39) missense probably benign 0.03
R6181:Urb1 UTSW 16 90,575,982 (GRCm39) missense probably benign 0.00
R6268:Urb1 UTSW 16 90,550,807 (GRCm39) missense probably benign 0.03
R6429:Urb1 UTSW 16 90,559,318 (GRCm39) splice site probably null
R6572:Urb1 UTSW 16 90,584,302 (GRCm39) missense probably benign 0.37
R6606:Urb1 UTSW 16 90,607,156 (GRCm39) missense probably benign 0.00
R6730:Urb1 UTSW 16 90,575,971 (GRCm39) missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90,578,994 (GRCm39) missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90,588,054 (GRCm39) missense probably damaging 1.00
R7238:Urb1 UTSW 16 90,549,003 (GRCm39) missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7341:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7361:Urb1 UTSW 16 90,571,656 (GRCm39) missense probably damaging 0.99
R7365:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7366:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7440:Urb1 UTSW 16 90,584,296 (GRCm39) missense probably damaging 1.00
R7530:Urb1 UTSW 16 90,558,522 (GRCm39) missense probably damaging 1.00
R7553:Urb1 UTSW 16 90,589,752 (GRCm39) missense probably damaging 1.00
R7557:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7603:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7607:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7609:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7610:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7612:Urb1 UTSW 16 90,594,798 (GRCm39) missense probably damaging 1.00
R7613:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7684:Urb1 UTSW 16 90,583,006 (GRCm39) nonsense probably null
R8324:Urb1 UTSW 16 90,588,078 (GRCm39) missense probably damaging 1.00
R8680:Urb1 UTSW 16 90,571,513 (GRCm39) missense probably benign 0.00
R8785:Urb1 UTSW 16 90,600,311 (GRCm39) missense probably benign 0.07
R8914:Urb1 UTSW 16 90,607,122 (GRCm39) missense probably damaging 1.00
R8959:Urb1 UTSW 16 90,571,005 (GRCm39) missense probably benign 0.26
R9005:Urb1 UTSW 16 90,550,678 (GRCm39) missense probably benign 0.01
R9126:Urb1 UTSW 16 90,566,290 (GRCm39) missense possibly damaging 0.53
R9195:Urb1 UTSW 16 90,589,638 (GRCm39) missense probably benign 0.03
R9276:Urb1 UTSW 16 90,569,463 (GRCm39) splice site probably benign
R9534:Urb1 UTSW 16 90,583,096 (GRCm39) missense possibly damaging 0.54
Z1177:Urb1 UTSW 16 90,571,750 (GRCm39) missense probably benign 0.05
Z1177:Urb1 UTSW 16 90,550,771 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCACGTAAGCAGAGGACAG -3'
(R):5'- CTGATGTGAATATGGAAGGGCATC -3'

Sequencing Primer
(F):5'- AAGGTGAAGGCCCGACTCTG -3'
(R):5'- AGGGCATCAGGTCAGTATCTC -3'
Posted On 2020-01-23