Incidental Mutation 'R8029:Vmn2r117'
ID 617856
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Name vomeronasal 2, receptor 117
Synonyms EG619788
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23459675-23479597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23477770 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 221 (D221V)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
AlphaFold K7N6V1
Predicted Effect probably benign
Transcript: ENSMUST00000171996
AA Change: D221V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: D221V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23477840 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23475429 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23479546 missense probably benign
IGL01078:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23478382 missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23477241 missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23475382 missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23477225 missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23459784 missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23475578 splice site probably benign
IGL03167:Vmn2r117 APN 17 23477707 missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23460165 missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23475514 missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23475503 nonsense probably null
R1411:Vmn2r117 UTSW 17 23460553 missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23478473 missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23477455 missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23478389 missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23477480 missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23477644 missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23460256 missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23459911 missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23460106 missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23479513 frame shift probably null
R4560:Vmn2r117 UTSW 17 23459877 missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23478416 missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23477885 missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23459838 missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23479513 frame shift probably null
R5078:Vmn2r117 UTSW 17 23460148 missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23477874 nonsense probably null
R5774:Vmn2r117 UTSW 17 23477202 missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23479561 missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23460114 missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23460219 missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23460049 nonsense probably null
R6736:Vmn2r117 UTSW 17 23478308 missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23479563 missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23477203 missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23475385 missense probably benign 0.06
R7440:Vmn2r117 UTSW 17 23475565 missense probably benign 0.26
R7443:Vmn2r117 UTSW 17 23460133 missense probably benign 0.25
R7443:Vmn2r117 UTSW 17 23460345 missense probably damaging 1.00
R7449:Vmn2r117 UTSW 17 23459895 missense probably damaging 1.00
R7644:Vmn2r117 UTSW 17 23477291 missense probably damaging 0.98
R7914:Vmn2r117 UTSW 17 23460126 missense possibly damaging 0.95
R8001:Vmn2r117 UTSW 17 23479407 missense possibly damaging 0.89
R8340:Vmn2r117 UTSW 17 23460537 missense probably benign 0.01
R8519:Vmn2r117 UTSW 17 23479468 missense probably benign
R8723:Vmn2r117 UTSW 17 23477369 missense probably damaging 1.00
R8914:Vmn2r117 UTSW 17 23460169 missense probably benign 0.02
R9010:Vmn2r117 UTSW 17 23460471 missense probably benign 0.10
R9129:Vmn2r117 UTSW 17 23459944 nonsense probably null
R9244:Vmn2r117 UTSW 17 23477615 missense probably damaging 0.98
R9464:Vmn2r117 UTSW 17 23477604 missense probably benign 0.23
R9620:Vmn2r117 UTSW 17 23478476 missense probably damaging 0.97
V5622:Vmn2r117 UTSW 17 23477840 missense probably damaging 1.00
V5622:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
Z1176:Vmn2r117 UTSW 17 23459766 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGGTGATCCATAGTCTCTG -3'
(R):5'- AGTTCCTTCAGATTACTTATGGACC -3'

Sequencing Primer
(F):5'- ACAGCTAAGGTACTGTCTGTGTCAC -3'
(R):5'- AGATTACTTATGGACCCTTTCATCC -3'
Posted On 2020-01-23