Incidental Mutation 'R8029:Chsy3'
ID 617862
Institutional Source Beutler Lab
Gene Symbol Chsy3
Ensembl Gene ENSMUSG00000058152
Gene Name chondroitin sulfate synthase 3
Synonyms 4833446K15Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001081328.1; MGI:1926173

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 59175401-59410446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59179447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 331 (I331V)
Ref Sequence ENSEMBL: ENSMUSP00000079546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080721]
AlphaFold Q5DTK1
Predicted Effect possibly damaging
Transcript: ENSMUST00000080721
AA Change: I331V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079546
Gene: ENSMUSG00000058152
AA Change: I331V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 84 96 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Pfam:Fringe 169 410 9.4e-19 PFAM
Pfam:CHGN 330 866 1.4e-194 PFAM
Pfam:Glyco_tranf_2_2 652 841 1.8e-7 PFAM
Pfam:Glyco_transf_7C 769 839 3.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSS3 is a glycosyltransferase that has both glucuronyltransferase and N-acetylgalactosaminyltransferase activities (Yada et al., 2003 [PubMed 12907687]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Chsy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Chsy3 APN 18 59176367 missense probably damaging 1.00
IGL01543:Chsy3 APN 18 59410400 nonsense probably null
IGL01627:Chsy3 APN 18 59176295 missense probably damaging 1.00
IGL02232:Chsy3 APN 18 59409311 missense possibly damaging 0.89
IGL02604:Chsy3 APN 18 59409115 missense probably benign 0.00
IGL02888:Chsy3 APN 18 59409995 missense probably benign 0.00
IGL03199:Chsy3 APN 18 59176401 missense probably damaging 1.00
bajo UTSW 18 59176166 frame shift probably null
bajo2 UTSW 18 59176419 missense probably damaging 1.00
inferior UTSW 18 59176415 missense probably damaging 1.00
P0045:Chsy3 UTSW 18 59409006 nonsense probably null
R0456:Chsy3 UTSW 18 59176478 missense probably damaging 1.00
R0605:Chsy3 UTSW 18 59409053 missense probably damaging 0.97
R1068:Chsy3 UTSW 18 59410289 missense probably damaging 1.00
R1479:Chsy3 UTSW 18 59408913 missense probably benign 0.09
R1654:Chsy3 UTSW 18 59176416 missense probably damaging 1.00
R1868:Chsy3 UTSW 18 59176488 splice site probably null
R1938:Chsy3 UTSW 18 59409512 missense probably damaging 1.00
R2114:Chsy3 UTSW 18 59179489 missense probably damaging 1.00
R2146:Chsy3 UTSW 18 59176472 missense probably benign 0.04
R3693:Chsy3 UTSW 18 59176008 missense possibly damaging 0.88
R3787:Chsy3 UTSW 18 59408998 missense probably damaging 1.00
R3811:Chsy3 UTSW 18 59176170 missense probably benign 0.42
R3878:Chsy3 UTSW 18 59409773 missense probably damaging 1.00
R4385:Chsy3 UTSW 18 59176352 missense probably benign 0.00
R4385:Chsy3 UTSW 18 59179474 missense possibly damaging 0.95
R4512:Chsy3 UTSW 18 59410187 missense probably damaging 1.00
R4734:Chsy3 UTSW 18 59179413 missense probably benign 0.07
R4751:Chsy3 UTSW 18 59175800 missense possibly damaging 0.66
R4982:Chsy3 UTSW 18 59409575 missense probably benign 0.07
R4982:Chsy3 UTSW 18 59409767 missense possibly damaging 0.78
R5032:Chsy3 UTSW 18 59179471 missense probably damaging 1.00
R5088:Chsy3 UTSW 18 59179535 missense probably damaging 1.00
R5220:Chsy3 UTSW 18 59410030 missense probably damaging 0.99
R5257:Chsy3 UTSW 18 59409794 missense possibly damaging 0.50
R5259:Chsy3 UTSW 18 59410246 missense probably damaging 0.96
R5558:Chsy3 UTSW 18 59176397 missense probably damaging 1.00
R5872:Chsy3 UTSW 18 59176196 missense probably damaging 1.00
R5990:Chsy3 UTSW 18 59176166 frame shift probably null
R5992:Chsy3 UTSW 18 59176166 frame shift probably null
R6064:Chsy3 UTSW 18 59176166 frame shift probably null
R6065:Chsy3 UTSW 18 59176166 frame shift probably null
R6182:Chsy3 UTSW 18 59179342 missense probably benign 0.00
R6881:Chsy3 UTSW 18 59179408 missense probably damaging 1.00
R6985:Chsy3 UTSW 18 59176488 splice site probably null
R7046:Chsy3 UTSW 18 59409803 missense probably benign 0.00
R7078:Chsy3 UTSW 18 59176077 missense possibly damaging 0.51
R7105:Chsy3 UTSW 18 59176419 missense probably damaging 1.00
R7129:Chsy3 UTSW 18 59410298 missense probably damaging 1.00
R7151:Chsy3 UTSW 18 59409285 missense possibly damaging 0.55
R7224:Chsy3 UTSW 18 59408975 missense probably damaging 1.00
R7860:Chsy3 UTSW 18 59409227 missense probably benign 0.10
R7936:Chsy3 UTSW 18 59409346 missense probably damaging 1.00
R8010:Chsy3 UTSW 18 59410154 missense probably damaging 1.00
R8215:Chsy3 UTSW 18 59175869 nonsense probably null
R8332:Chsy3 UTSW 18 59409015 missense probably damaging 0.98
R8375:Chsy3 UTSW 18 59179513 missense probably damaging 1.00
R8560:Chsy3 UTSW 18 59410058 missense possibly damaging 0.91
R8700:Chsy3 UTSW 18 59176415 missense probably damaging 1.00
R9040:Chsy3 UTSW 18 59409688 missense probably damaging 0.98
R9290:Chsy3 UTSW 18 59409856 missense probably benign 0.00
R9413:Chsy3 UTSW 18 59176098 missense possibly damaging 0.66
R9490:Chsy3 UTSW 18 59179414 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGTGAAATGAGGACAG -3'
(R):5'- TACATAGGACTGTTGCCCAGGATG -3'

Sequencing Primer
(F):5'- AGGTGACTCTCGGCTTTCTC -3'
(R):5'- ATGCAAAGCGCCATCCTTGTTAG -3'
Posted On 2020-01-23