Incidental Mutation 'R0659:Mmp21'
ID61787
Institutional Source Beutler Lab
Gene Symbol Mmp21
Ensembl Gene ENSMUSG00000030981
Gene Namematrix metallopeptidase 21
Synonyms
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0659 (G1)
Quality Score91
Status Validated
Chromosome7
Chromosomal Location133674270-133680061 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 133677667 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033278] [ENSMUST00000051169] [ENSMUST00000122136]
Predicted Effect probably benign
Transcript: ENSMUST00000033278
SMART Domains Protein: ENSMUSP00000033278
Gene: ENSMUSG00000030981

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 5.6e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
HX 332 390 1.97e-1 SMART
HX 393 448 5.36e-6 SMART
HX 450 497 9.33e-6 SMART
HX 505 548 1.11e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051169
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122136
SMART Domains Protein: ENSMUSP00000113853
Gene: ENSMUSG00000030981

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 1.9e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
Pfam:Hemopexin 351 390 4.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131894
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. Mice harboring certain mutations in this gene exhibit congenital heart defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit heterotaxia and congenital cardiovascular defects including d-loop transposition of the great arteries, tricupid valve atresia, and ventricular septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Mmp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Mmp21 APN 7 133675914 missense probably damaging 1.00
IGL02822:Mmp21 APN 7 133676099 missense possibly damaging 0.80
IGL03240:Mmp21 APN 7 133674571 missense probably damaging 0.97
IGL03261:Mmp21 APN 7 133674674 missense probably benign 0.01
R1037:Mmp21 UTSW 7 133674453 missense probably benign 0.16
R1463:Mmp21 UTSW 7 133675859 splice site probably null
R1523:Mmp21 UTSW 7 133679045 missense probably benign
R1710:Mmp21 UTSW 7 133677285 missense probably damaging 1.00
R1804:Mmp21 UTSW 7 133678882 missense probably benign 0.01
R1848:Mmp21 UTSW 7 133677153 missense probably benign 0.05
R2993:Mmp21 UTSW 7 133678986 missense probably damaging 1.00
R3431:Mmp21 UTSW 7 133678750 missense probably benign 0.00
R4790:Mmp21 UTSW 7 133675030 missense probably damaging 1.00
R4870:Mmp21 UTSW 7 133678677 missense probably damaging 1.00
R5134:Mmp21 UTSW 7 133679013 missense probably benign 0.00
R5347:Mmp21 UTSW 7 133675922 missense probably benign
R5682:Mmp21 UTSW 7 133674629 missense probably benign 0.00
R5905:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6028:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6936:Mmp21 UTSW 7 133678975 missense probably benign 0.01
R7657:Mmp21 UTSW 7 133678833 missense probably benign 0.00
R7702:Mmp21 UTSW 7 133679062 missense probably damaging 1.00
R7786:Mmp21 UTSW 7 133675035 missense probably benign
Z1177:Mmp21 UTSW 7 133674933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGAGAAGGCTGATGCCTGTG -3'
(R):5'- TTCCTTCACCAGCACTGGCAAC -3'

Sequencing Primer
(F):5'- ATGCCTGTGTCACTGGAGAG -3'
(R):5'- gagagagagagagagagagagag -3'
Posted On2013-07-30