Mutagenetix > Incidental Mutation

Incidental Mutation 'R8030:Kirrel1'

617878

Institutional Source

Beutler Lab

Gene Symbol

Kirrel1

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

6720469N11Rik, Neph1, Kirrel1, Kirrel

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8030 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86985900-87082054 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 87005082 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 89 (G89W)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably damaging
Transcript: ENSMUST00000041732
AA Change: G89W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: G89W

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107618
AA Change: G89W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: G89W

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159976
AA Change: G89W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: G89W

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B09Rik	A	G	9: 14,672,970 (GRCm39)	S98P	probably benign	Het
Abca9	C	T	11: 110,011,534 (GRCm39)	V1170I	probably benign	Het
Acacb	A	G	5: 114,371,228 (GRCm39)	T1786A	probably damaging	Het
Acmsd	T	C	1: 127,676,898 (GRCm39)	I141T	possibly damaging	Het
Akr1c12	A	G	13: 4,322,244 (GRCm39)	V266A	possibly damaging	Het
Arhgef18	A	T	8: 3,489,600 (GRCm39)	I311F	probably damaging	Het
Armc2	T	A	10: 41,842,738 (GRCm39)	N355I	possibly damaging	Het
Armh1	T	A	4: 117,087,184 (GRCm39)	K160N	probably benign	Het
Asic1	A	T	15: 99,592,722 (GRCm39)	T236S	possibly damaging	Het
Avl9	T	A	6: 56,718,407 (GRCm39)	D424E	probably damaging	Het
Cbfa2t2	A	T	2: 154,357,816 (GRCm39)	Q197L	probably damaging	Het
Ccdc136	T	C	6: 29,417,141 (GRCm39)	V654A	probably benign	Het
Cd177	C	T	7: 24,455,594 (GRCm39)	W309*	probably null	Het
Cplane1	G	T	15: 8,259,787 (GRCm39)	G2383V	probably damaging	Het
Cracr2a	A	G	6: 127,588,386 (GRCm39)	K182E	probably damaging	Het
Dpys	T	C	15: 39,691,486 (GRCm39)	T279A	possibly damaging	Het
Dsc1	A	T	18: 20,222,628 (GRCm39)	S615T	probably benign	Het
Dsc2	C	T	18: 20,165,331 (GRCm39)	G881R	possibly damaging	Het
Efcab14	A	G	4: 115,623,599 (GRCm39)	Q390R	probably benign	Het
Eif4ebp2	G	A	10: 61,270,825 (GRCm39)	A68V	probably damaging	Het
Fam81a	A	G	9: 70,010,191 (GRCm39)	S149P	probably benign	Het
Ffar4	A	G	19: 38,095,839 (GRCm39)	I193V	possibly damaging	Het
Flvcr2	T	A	12: 85,845,312 (GRCm39)	V377D	probably damaging	Het
Fscn1	C	T	5: 142,946,756 (GRCm39)	R185C	possibly damaging	Het
Gucy1b2	C	T	14: 62,630,319 (GRCm39)	S809N	probably benign	Het
H60b	T	A	10: 22,163,020 (GRCm39)	N198K	probably damaging	Het
Helz2	A	T	2: 180,879,689 (GRCm39)	F643Y	possibly damaging	Het
Kash5	CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC	CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC	7: 44,837,608 (GRCm39)		probably benign	Het
Kif28	A	G	1: 179,526,629 (GRCm39)	V846A	probably benign	Het
Krt42	G	C	11: 100,155,865 (GRCm39)	R294G	possibly damaging	Het
Mb21d2	A	G	16: 28,646,555 (GRCm39)	F473S	probably damaging	Het
Mcrip2	G	A	17: 26,083,306 (GRCm39)	Q111*	probably null	Het
Msh5	A	G	17: 35,248,724 (GRCm39)	Y741H	possibly damaging	Het
Myo7b	A	G	18: 32,131,135 (GRCm39)	I544T	probably damaging	Het
Nav1	T	C	1: 135,464,977 (GRCm39)	E276G	probably damaging	Het
Nr2f1	T	C	13: 78,343,565 (GRCm39)	N233S	probably benign	Het
Nrip2	A	T	6: 128,383,484 (GRCm39)	D124V	possibly damaging	Het
Or5al1	C	T	2: 85,990,586 (GRCm39)	V43I	probably benign	Het
Or8k16	T	A	2: 85,520,063 (GRCm39)	C97S	probably damaging	Het
Panx2	G	T	15: 88,952,282 (GRCm39)	A250S	probably damaging	Het
Pdc	T	C	1: 150,208,964 (GRCm39)	L149P	probably damaging	Het
Pex5l	T	A	3: 33,008,568 (GRCm39)	I445F	possibly damaging	Het
Pigc	T	C	1: 161,798,116 (GRCm39)	F33L	probably damaging	Het
Pkp2	A	T	16: 16,064,774 (GRCm39)	M433L	probably benign	Het
Rbfox2	A	G	15: 76,969,776 (GRCm39)		probably null	Het
Rd3l	A	G	12: 111,946,584 (GRCm39)	L64P	possibly damaging	Het
Rnf220	A	G	4: 117,135,025 (GRCm39)	Y409H	probably damaging	Het
Rsf1	G	GACGGCGGCC	7: 97,229,116 (GRCm39)		probably benign	Het
Sel1l2	T	C	2: 140,082,938 (GRCm39)	T567A	probably damaging	Het
Slc22a8	T	C	19: 8,587,371 (GRCm39)	I477T	probably damaging	Het
Sltm	C	T	9: 70,493,261 (GRCm39)	R753*	probably null	Het
Specc1l	T	A	10: 75,084,389 (GRCm39)	M687K	probably damaging	Het
Spock3	T	G	8: 63,805,232 (GRCm39)	C338G	probably damaging	Het
Ssh2	C	A	11: 77,345,332 (GRCm39)	Q1106K	probably benign	Het
Sycp2l	A	G	13: 41,326,146 (GRCm39)	M251V	not run	Het
Tdrd5	C	A	1: 156,098,165 (GRCm39)	E711*	probably null	Het
Thop1	T	C	10: 80,911,450 (GRCm39)	M112T	possibly damaging	Het
Tln1	C	T	4: 43,535,737 (GRCm39)		probably null	Het
Ttc28	A	C	5: 111,433,922 (GRCm39)	I2319L	possibly damaging	Het
Ttll11	A	G	2: 35,792,685 (GRCm39)	I386T	probably damaging	Het
Txndc8	T	C	4: 57,984,178 (GRCm39)	E151G	probably damaging	Het
Ubr1	T	C	2: 120,764,855 (GRCm39)	E533G	probably damaging	Het
Zscan4f	A	G	7: 11,135,290 (GRCm39)	H232R	probably benign	Het

Other mutations in Kirrel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel1	APN	3	86,997,182 (GRCm39)	missense	probably benign	0.22
IGL01865:Kirrel1	APN	3	86,993,731 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kirrel1	APN	3	87,003,037 (GRCm39)	missense	probably damaging	1.00
IGL02337:Kirrel1	APN	3	86,996,519 (GRCm39)	missense	possibly damaging	0.64
IGL02724:Kirrel1	APN	3	86,997,780 (GRCm39)	nonsense	probably null
IGL02825:Kirrel1	APN	3	86,996,595 (GRCm39)	splice site	probably benign
IGL02826:Kirrel1	APN	3	86,995,792 (GRCm39)	missense	probably damaging	1.00
IGL03102:Kirrel1	APN	3	86,990,807 (GRCm39)	missense	probably damaging	0.98
D4043:Kirrel1	UTSW	3	86,990,510 (GRCm39)	missense	probably benign	0.02
R0360:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0364:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0421:Kirrel1	UTSW	3	86,990,914 (GRCm39)	missense	probably damaging	0.99
R0503:Kirrel1	UTSW	3	87,005,109 (GRCm39)	missense	probably benign	0.20
R1112:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1116:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1144:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1190:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1226:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1501:Kirrel1	UTSW	3	86,997,779 (GRCm39)	missense	probably benign	0.02
R1538:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1546:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1628:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1630:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1631:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1664:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1671:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1695:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1769:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1807:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1808:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1840:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1995:Kirrel1	UTSW	3	87,003,093 (GRCm39)	missense	possibly damaging	0.88
R2014:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2086:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2108:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2354:Kirrel1	UTSW	3	86,995,792 (GRCm39)	missense	probably damaging	0.98
R2407:Kirrel1	UTSW	3	86,992,150 (GRCm39)	missense	probably benign	0.03
R2904:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2905:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2958:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2959:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2960:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2961:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3026:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3028:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3034:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R3149:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3195:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3196:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3499:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3699:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3720:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3721:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3788:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3793:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3877:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3901:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3910:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3911:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3912:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3913:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3930:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3931:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4022:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4067:Kirrel1	UTSW	3	86,995,774 (GRCm39)	nonsense	probably null
R4077:Kirrel1	UTSW	3	86,992,387 (GRCm39)	critical splice donor site	probably null
R4198:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4328:Kirrel1	UTSW	3	86,992,081 (GRCm39)	intron	probably benign
R4355:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4363:Kirrel1	UTSW	3	86,997,792 (GRCm39)	nonsense	probably null
R4378:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4386:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4460:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4468:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4469:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4650:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4652:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4734:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4748:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4749:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R5304:Kirrel1	UTSW	3	86,996,902 (GRCm39)	missense	probably benign	0.02
R5534:Kirrel1	UTSW	3	86,997,825 (GRCm39)	missense	probably damaging	1.00
R5604:Kirrel1	UTSW	3	86,996,462 (GRCm39)	missense	possibly damaging	0.69
R7199:Kirrel1	UTSW	3	86,990,695 (GRCm39)	missense	probably benign	0.02
R7221:Kirrel1	UTSW	3	86,993,704 (GRCm39)	nonsense	probably null
R7284:Kirrel1	UTSW	3	86,990,694 (GRCm39)	missense	probably benign	0.02
R7332:Kirrel1	UTSW	3	86,995,705 (GRCm39)	missense	probably benign	0.14
R7369:Kirrel1	UTSW	3	87,048,391 (GRCm39)	missense	probably benign	0.20
R7371:Kirrel1	UTSW	3	86,995,729 (GRCm39)	missense	probably benign	0.44
R7508:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R7566:Kirrel1	UTSW	3	86,995,791 (GRCm39)	missense	probably damaging	1.00
R7567:Kirrel1	UTSW	3	87,002,988 (GRCm39)	missense	probably damaging	0.99
R7621:Kirrel1	UTSW	3	86,995,528 (GRCm39)	missense	possibly damaging	0.70
R8141:Kirrel1	UTSW	3	86,993,735 (GRCm39)	nonsense	probably null
R8261:Kirrel1	UTSW	3	86,995,309 (GRCm39)	intron	probably benign
R8477:Kirrel1	UTSW	3	86,992,138 (GRCm39)	missense	possibly damaging	0.71
R8512:Kirrel1	UTSW	3	86,995,534 (GRCm39)	missense	probably benign	0.00
R8954:Kirrel1	UTSW	3	86,997,173 (GRCm39)	missense	probably benign	0.25
R8987:Kirrel1	UTSW	3	86,992,400 (GRCm39)	missense	probably damaging	1.00
R9058:Kirrel1	UTSW	3	86,992,442 (GRCm39)	missense	probably benign	0.18
R9146:Kirrel1	UTSW	3	87,003,015 (GRCm39)	missense	probably damaging	1.00
R9311:Kirrel1	UTSW	3	87,005,123 (GRCm39)	missense	probably benign	0.29
R9527:Kirrel1	UTSW	3	86,996,912 (GRCm39)	nonsense	probably null
R9629:Kirrel1	UTSW	3	87,003,025 (GRCm39)	nonsense	probably null
Z1177:Kirrel1	UTSW	3	86,991,182 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGACAGACCTGAGGAGTC -3'
(R):5'- ATGGGGTACTGTGAGGAACC -3'

Sequencing Primer
(F):5'- CCAGGAATCTAGGCTGAGAGC -3'
(R):5'- GGAACCCTCCTCACTCATTG -3'

Posted On

2020-01-23