Incidental Mutation 'R8030:Tln1'
ID617879
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 43535737 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000030187
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43554309 missense probably benign 0.01
R7874:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7874:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R7919:Tln1 UTSW 4 43554309 missense probably benign 0.01
R7949:Tln1 UTSW 4 43536148 splice site probably null
R7957:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7957:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R8105:Tln1 UTSW 4 43538231 missense probably benign 0.32
R8212:Tln1 UTSW 4 43555918 missense probably damaging 1.00
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Z1176:Tln1 UTSW 4 43543211 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGTTCCTGACGTATGTGCTCTG -3'
(R):5'- TCGCTGATGTGGTCAAGCTC -3'

Sequencing Primer
(F):5'- GCTCTGTGGTTGCCTCTAG -3'
(R):5'- TGGTCAAGCTCGGTGCAG -3'
Posted On2020-01-23