Incidental Mutation 'R8030:Ccdc136'
ID617887
Institutional Source Beutler Lab
Gene Symbol Ccdc136
Ensembl Gene ENSMUSG00000029769
Gene Namecoiled-coil domain containing 136
Synonyms4921511K06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location29396309-29426994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29417142 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 654 (V654A)
Ref Sequence ENSEMBL: ENSMUSP00000137673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096084] [ENSMUST00000115275] [ENSMUST00000145310] [ENSMUST00000154619] [ENSMUST00000180829] [ENSMUST00000181464] [ENSMUST00000202726]
Predicted Effect probably benign
Transcript: ENSMUST00000096084
AA Change: V746A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093789
Gene: ENSMUSG00000029769
AA Change: V746A

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 7.26e-6 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 8.87e-9 PROSPERO
internal_repeat_1 819 838 8.87e-9 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 7.26e-6 PROSPERO
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
coiled coil region 1066 1104 N/A INTRINSIC
low complexity region 1108 1142 N/A INTRINSIC
transmembrane domain 1154 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115275
AA Change: V746A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110930
Gene: ENSMUSG00000029769
AA Change: V746A

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 1.72e-5 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 2.93e-8 PROSPERO
internal_repeat_1 819 838 2.93e-8 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 1.72e-5 PROSPERO
transmembrane domain 967 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145310
SMART Domains Protein: ENSMUSP00000145331
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154619
AA Change: V588A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118132
Gene: ENSMUSG00000029769
AA Change: V588A

DomainStartEndE-ValueType
coiled coil region 1 152 N/A INTRINSIC
coiled coil region 185 250 N/A INTRINSIC
internal_repeat_2 258 277 4.68e-6 PROSPERO
low complexity region 281 295 N/A INTRINSIC
coiled coil region 305 331 N/A INTRINSIC
coiled coil region 368 453 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
coiled coil region 572 621 N/A INTRINSIC
internal_repeat_1 633 652 5.47e-9 PROSPERO
internal_repeat_1 661 680 5.47e-9 PROSPERO
low complexity region 689 710 N/A INTRINSIC
internal_repeat_2 744 763 4.68e-6 PROSPERO
low complexity region 836 853 N/A INTRINSIC
low complexity region 865 883 N/A INTRINSIC
coiled coil region 908 946 N/A INTRINSIC
low complexity region 950 984 N/A INTRINSIC
transmembrane domain 996 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180829
AA Change: V654A

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137747
Gene: ENSMUSG00000029769
AA Change: V654A

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 1.21e-5 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.98e-8 PROSPERO
internal_repeat_1 727 746 1.98e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 1.21e-5 PROSPERO
transmembrane domain 875 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181464
AA Change: V654A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137673
Gene: ENSMUSG00000029769
AA Change: V654A

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 7.68e-6 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.04e-8 PROSPERO
internal_repeat_1 727 746 1.04e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 7.68e-6 PROSPERO
low complexity region 902 919 N/A INTRINSIC
low complexity region 931 949 N/A INTRINSIC
transmembrane domain 969 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202726
SMART Domains Protein: ENSMUSP00000144577
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
coiled coil region 25 90 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Ccdc136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Ccdc136 APN 6 29420258 missense probably damaging 0.96
IGL01325:Ccdc136 APN 6 29412950 missense probably benign 0.00
IGL01608:Ccdc136 APN 6 29406114 missense possibly damaging 0.90
IGL02305:Ccdc136 APN 6 29406174 missense probably damaging 1.00
IGL03354:Ccdc136 APN 6 29419103 missense probably damaging 1.00
dimensionless UTSW 6 29412450 missense probably benign 0.03
punctate UTSW 6 29410205 missense probably damaging 0.99
PIT4515001:Ccdc136 UTSW 6 29417226 missense probably benign 0.42
R0436:Ccdc136 UTSW 6 29414934 missense probably damaging 1.00
R0709:Ccdc136 UTSW 6 29414970 missense possibly damaging 0.64
R1451:Ccdc136 UTSW 6 29419377 missense probably benign 0.09
R1593:Ccdc136 UTSW 6 29415584 missense probably damaging 1.00
R1966:Ccdc136 UTSW 6 29418092 missense probably damaging 1.00
R2113:Ccdc136 UTSW 6 29413032 missense possibly damaging 0.51
R3845:Ccdc136 UTSW 6 29417177 missense probably benign 0.20
R4668:Ccdc136 UTSW 6 29411281 missense probably damaging 0.99
R5037:Ccdc136 UTSW 6 29417123 missense probably damaging 1.00
R5085:Ccdc136 UTSW 6 29419314 missense probably damaging 1.00
R5314:Ccdc136 UTSW 6 29417498 missense probably benign 0.07
R5340:Ccdc136 UTSW 6 29411860 missense possibly damaging 0.84
R5702:Ccdc136 UTSW 6 29412982 missense probably damaging 0.99
R6108:Ccdc136 UTSW 6 29412450 missense probably benign 0.03
R6313:Ccdc136 UTSW 6 29410205 missense probably damaging 0.99
R6640:Ccdc136 UTSW 6 29412960 missense possibly damaging 0.95
R6765:Ccdc136 UTSW 6 29405941 missense probably benign
R7910:Ccdc136 UTSW 6 29420034 missense probably benign 0.08
X0025:Ccdc136 UTSW 6 29409243 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GCAAAGGCCTTGTGAAACAG -3'
(R):5'- CTCTCGTAACTCCTGTGGAAG -3'

Sequencing Primer
(F):5'- GTGCTCTTCTCTCAGGTAAGCAC -3'
(R):5'- AACTCCTGTGGAAGTTCTCAG -3'
Posted On2020-01-23