Incidental Mutation 'R8030:Zscan4f'
ID617891
Institutional Source Beutler Lab
Gene Symbol Zscan4f
Ensembl Gene ENSMUSG00000070828
Gene Namezinc finger and SCAN domain containing 4F
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location11397915-11402318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11401363 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 232 (H232R)
Ref Sequence ENSEMBL: ENSMUSP00000120149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141491] [ENSMUST00000145237]
Predicted Effect probably benign
Transcript: ENSMUST00000141491
SMART Domains Protein: ENSMUSP00000122083
Gene: ENSMUSG00000070828

DomainStartEndE-ValueType
Pfam:SCAN 33 77 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145237
AA Change: H232R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120149
Gene: ENSMUSG00000070828
AA Change: H232R

DomainStartEndE-ValueType
Pfam:SCAN 43 122 3.7e-17 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 2.75e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Other mutations in Zscan4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03253:Zscan4f APN 7 11401343 missense probably benign 0.07
R1719:Zscan4f UTSW 7 11401327 missense possibly damaging 0.94
R4094:Zscan4f UTSW 7 11401258 missense probably damaging 1.00
R7602:Zscan4f UTSW 7 11401381 missense possibly damaging 0.79
R7757:Zscan4f UTSW 7 11401278 nonsense probably null
R8094:Zscan4f UTSW 7 11401227 missense possibly damaging 0.86
R8280:Zscan4f UTSW 7 11517672 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGGCCACAGGTTAGTTGG -3'
(R):5'- CTTGAGTAGCTGCATTTCTGGAAG -3'

Sequencing Primer
(F):5'- CATAGATTGTCTTCTTTCCAAAGGAC -3'
(R):5'- AGCTGCATTTCTGGAAGTGTTATAGC -3'
Posted On2020-01-23