Incidental Mutation 'R8030:Ccdc155'
ID617893
Institutional Source Beutler Lab
Gene Symbol Ccdc155
Ensembl Gene ENSMUSG00000038292
Gene Namecoiled-coil domain containing 155
SynonymsKASH5, LOC384619
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8030 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location45183624-45204892 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC to CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC at 45188184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121017]
Predicted Effect probably benign
Transcript: ENSMUST00000121017
SMART Domains Protein: ENSMUSP00000113616
Gene: ENSMUSG00000038292

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:EF-hand_9 108 175 8e-31 PFAM
Pfam:KASH_CCD 227 419 2.4e-90 PFAM
low complexity region 472 498 N/A INTRINSIC
low complexity region 607 633 N/A INTRINSIC
low complexity region 638 647 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are infertile. Females have small ovaries and lack ovarian follicles. Males exhibit small testes and seminiferous tubules, lack of mature sperm, increased testis apoptosis, and meiotic arrest along with limited homologous chromosome pairing and unresolved double-strand breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Ccdc155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Ccdc155 APN 7 45185306 missense possibly damaging 0.72
IGL01120:Ccdc155 APN 7 45184198 missense probably damaging 0.99
IGL01620:Ccdc155 APN 7 45189960 missense probably damaging 0.98
IGL01643:Ccdc155 APN 7 45200286 missense probably damaging 0.99
IGL02528:Ccdc155 APN 7 45183746 unclassified probably benign
PIT4585001:Ccdc155 UTSW 7 45200271 missense probably benign 0.02
R0240:Ccdc155 UTSW 7 45200251 missense probably benign 0.43
R1219:Ccdc155 UTSW 7 45189408 splice site probably benign
R1768:Ccdc155 UTSW 7 45188803 intron probably null
R5155:Ccdc155 UTSW 7 45189654 nonsense probably null
R5818:Ccdc155 UTSW 7 45193959 critical splice donor site probably null
R6746:Ccdc155 UTSW 7 45200311 missense probably benign 0.06
R7574:Ccdc155 UTSW 7 45204611 missense possibly damaging 0.53
R8032:Ccdc155 UTSW 7 45188184 small insertion probably benign
R8032:Ccdc155 UTSW 7 45188206 small insertion probably benign
Z1176:Ccdc155 UTSW 7 45184254 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGCCTGACTTTGTCTGTC -3'
(R):5'- AAACTCCAAGGCCATGTTCC -3'

Sequencing Primer
(F):5'- ACTTTGTCTGTCCCTTGAGG -3'
(R):5'- ACTCCAAGGCCATGTTCCTTAAC -3'
Posted On2020-01-23