Incidental Mutation 'R8030:Ssh2'
ID617905
Institutional Source Beutler Lab
Gene Symbol Ssh2
Ensembl Gene ENSMUSG00000037926
Gene Nameslingshot protein phosphatase 2
SynonymsSSH-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location77216287-77460220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 77454506 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1106 (Q1106K)
Ref Sequence ENSEMBL: ENSMUSP00000137933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]
Predicted Effect probably benign
Transcript: ENSMUST00000037912
AA Change: Q1100K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: Q1100K

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:DEK_C 251 302 3.1e-13 PFAM
DSPc 307 445 2.2e-41 SMART
low complexity region 459 469 N/A INTRINSIC
low complexity region 871 882 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181283
AA Change: Q1106K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: Q1106K

DomainStartEndE-ValueType
Pfam:DEK_C 256 309 1.7e-18 PFAM
DSPc 313 451 2.2e-41 SMART
low complexity region 465 475 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1376 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Ssh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Ssh2 APN 11 77441926 missense probably damaging 1.00
IGL01141:Ssh2 APN 11 77449726 missense probably damaging 1.00
IGL01520:Ssh2 APN 11 77449906 missense probably damaging 1.00
IGL01803:Ssh2 APN 11 77425330 missense probably damaging 0.99
IGL01989:Ssh2 APN 11 77453685 missense possibly damaging 0.79
IGL02322:Ssh2 APN 11 77416413 critical splice acceptor site probably null
IGL02466:Ssh2 APN 11 77416407 splice site probably benign
IGL02683:Ssh2 APN 11 77398256 missense probably damaging 0.99
IGL02706:Ssh2 APN 11 77453406 missense possibly damaging 0.68
IGL02719:Ssh2 APN 11 77425587 missense probably damaging 1.00
IGL02721:Ssh2 APN 11 77454725 nonsense probably null
IGL02732:Ssh2 APN 11 77437776 splice site probably null
IGL02745:Ssh2 APN 11 77455407 missense probably damaging 1.00
IGL02993:Ssh2 APN 11 77453544 missense probably damaging 1.00
IGL03000:Ssh2 APN 11 77421206 splice site probably benign
david UTSW 11 77425593 missense probably damaging 1.00
faba UTSW 11 77441985 missense probably damaging 1.00
goliath UTSW 11 77453523 missense possibly damaging 0.48
Vicia UTSW 11 77454966 missense possibly damaging 0.68
IGL03055:Ssh2 UTSW 11 77408195 nonsense probably null
R0024:Ssh2 UTSW 11 77454966 missense possibly damaging 0.68
R0374:Ssh2 UTSW 11 77408143 missense probably damaging 1.00
R0539:Ssh2 UTSW 11 77454794 missense probably benign 0.11
R0834:Ssh2 UTSW 11 77437633 missense possibly damaging 0.87
R1714:Ssh2 UTSW 11 77454024 missense possibly damaging 0.94
R1743:Ssh2 UTSW 11 77437756 missense probably damaging 1.00
R1889:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R1895:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R3945:Ssh2 UTSW 11 77454668 missense possibly damaging 0.93
R3947:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R3948:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R4133:Ssh2 UTSW 11 77421269 missense probably damaging 1.00
R4256:Ssh2 UTSW 11 77408183 missense possibly damaging 0.48
R4499:Ssh2 UTSW 11 77393067 nonsense probably null
R4548:Ssh2 UTSW 11 77450184 missense probably benign 0.20
R4644:Ssh2 UTSW 11 77449576 missense possibly damaging 0.46
R4690:Ssh2 UTSW 11 77455205 missense possibly damaging 0.62
R4788:Ssh2 UTSW 11 77429798 missense probably damaging 1.00
R4919:Ssh2 UTSW 11 77425320 missense possibly damaging 0.91
R5014:Ssh2 UTSW 11 77455276 nonsense probably null
R5380:Ssh2 UTSW 11 77453945 missense probably benign 0.01
R5574:Ssh2 UTSW 11 77450115 missense probably benign
R5593:Ssh2 UTSW 11 77421366 missense probably damaging 0.99
R5739:Ssh2 UTSW 11 77449813 missense probably damaging 1.00
R6180:Ssh2 UTSW 11 77453465 missense probably benign 0.43
R6542:Ssh2 UTSW 11 77450150 missense possibly damaging 0.94
R6713:Ssh2 UTSW 11 77449433 missense possibly damaging 0.89
R7108:Ssh2 UTSW 11 77454794 missense probably benign
R7124:Ssh2 UTSW 11 77454338 missense probably benign 0.00
R7255:Ssh2 UTSW 11 77425593 missense probably damaging 1.00
R7332:Ssh2 UTSW 11 77453523 missense possibly damaging 0.48
R7362:Ssh2 UTSW 11 77449650 missense probably benign 0.01
R7395:Ssh2 UTSW 11 77393073 missense probably damaging 0.99
R7412:Ssh2 UTSW 11 77450108 missense probably damaging 0.98
R7493:Ssh2 UTSW 11 77437716 missense probably benign 0.16
R7686:Ssh2 UTSW 11 77425324 missense possibly damaging 0.89
R7870:Ssh2 UTSW 11 77453615 missense probably benign
R7895:Ssh2 UTSW 11 77454626 missense probably benign 0.41
R7963:Ssh2 UTSW 11 77421356 missense possibly damaging 0.93
R8065:Ssh2 UTSW 11 77441985 missense probably damaging 1.00
R8099:Ssh2 UTSW 11 77454929 nonsense probably null
R8294:Ssh2 UTSW 11 77454201 missense probably benign 0.08
R8464:Ssh2 UTSW 11 77454253 nonsense probably null
R8469:Ssh2 UTSW 11 77449608 missense probably benign 0.41
R8547:Ssh2 UTSW 11 77449707 missense probably benign 0.10
R8677:Ssh2 UTSW 11 77455193 missense possibly damaging 0.77
R8758:Ssh2 UTSW 11 77454017 missense probably benign
RF018:Ssh2 UTSW 11 77454054 missense probably damaging 0.99
X0017:Ssh2 UTSW 11 77441898 missense probably damaging 1.00
Z1088:Ssh2 UTSW 11 77449495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATCACTGGGTCACACCG -3'
(R):5'- TACCACTGGAGAGGAAATGCC -3'

Sequencing Primer
(F):5'- TCACACCGAGCCAGGAG -3'
(R):5'- CAGCTAGCCTGCTCTGGAGAC -3'
Posted On2020-01-23