Incidental Mutation 'R8030:Flvcr2'
ID617908
Institutional Source Beutler Lab
Gene Symbol Flvcr2
Ensembl Gene ENSMUSG00000034258
Gene Namefeline leukemia virus subgroup C cellular receptor 2
SynonymsMfsd7c, CCT
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85746539-85813585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85798538 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 377 (V377D)
Ref Sequence ENSEMBL: ENSMUSP00000035569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040461]
Predicted Effect probably damaging
Transcript: ENSMUST00000040461
AA Change: V377D

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035569
Gene: ENSMUSG00000034258
AA Change: V377D

DomainStartEndE-ValueType
Pfam:MFS_1 113 477 1.7e-30 PFAM
transmembrane domain 488 510 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily. The encoded transmembrane protein is a calcium transporter. Unlike the related protein feline leukemia virus subgroup C receptor 1, the protein encoded by this locus does not bind to feline leukemia virus subgroup C envelope protein. The encoded protein may play a role in development of brain vascular endothelial cells, as mutations at this locus have been associated with proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Flvcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Flvcr2 APN 12 85747323 missense possibly damaging 0.91
IGL01461:Flvcr2 APN 12 85803131 splice site probably benign
IGL02191:Flvcr2 APN 12 85786192 nonsense probably null
IGL02643:Flvcr2 APN 12 85796223 missense possibly damaging 0.96
IGL02933:Flvcr2 APN 12 85803128 splice site probably benign
pulga UTSW 12 85747191 missense possibly damaging 0.94
R1792:Flvcr2 UTSW 12 85747155 nonsense probably null
R1840:Flvcr2 UTSW 12 85803221 missense possibly damaging 0.91
R2402:Flvcr2 UTSW 12 85783003 missense probably benign 0.12
R4120:Flvcr2 UTSW 12 85786129 missense probably benign 0.31
R4900:Flvcr2 UTSW 12 85782982 missense probably damaging 0.98
R5417:Flvcr2 UTSW 12 85747191 missense probably damaging 0.97
R5559:Flvcr2 UTSW 12 85804407 missense probably benign 0.21
R5639:Flvcr2 UTSW 12 85747476 missense probably benign 0.03
R5891:Flvcr2 UTSW 12 85796228 missense possibly damaging 0.74
R6347:Flvcr2 UTSW 12 85747420 missense possibly damaging 0.66
R6349:Flvcr2 UTSW 12 85747200 missense probably benign 0.30
R7082:Flvcr2 UTSW 12 85746954 missense probably benign 0.03
R7179:Flvcr2 UTSW 12 85747191 missense possibly damaging 0.94
R7241:Flvcr2 UTSW 12 85805239 missense probably benign
R7459:Flvcr2 UTSW 12 85747057 missense probably benign 0.14
RF013:Flvcr2 UTSW 12 85747186 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACAAAATTTGGCTGATCATGCTG -3'
(R):5'- AATTTGACCTCCAGCTGCTAC -3'

Sequencing Primer
(F):5'- CATACAGGGCCATAGATGTACAGTTG -3'
(R):5'- TCCAGCTGCTACCCCGC -3'
Posted On2020-01-23