Incidental Mutation 'R8030:Nr2f1'
ID617912
Institutional Source Beutler Lab
Gene Symbol Nr2f1
Ensembl Gene ENSMUSG00000069171
Gene Namenuclear receptor subfamily 2, group F, member 1
SynonymsErbal3, COUP-TF1, Tcfcoup1, COUP-TFI
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location78188973-78199757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78195446 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 233 (N233S)
Ref Sequence ENSEMBL: ENSMUSP00000089036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091458] [ENSMUST00000125176] [ENSMUST00000127137] [ENSMUST00000150498] [ENSMUST00000224798]
Predicted Effect probably benign
Transcript: ENSMUST00000091458
AA Change: N233S

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089036
Gene: ENSMUSG00000069171
AA Change: N233S

DomainStartEndE-ValueType
low complexity region 16 65 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ZnF_C4 80 151 3.01e-39 SMART
HOLI 218 378 5.16e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125176
AA Change: N86S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122618
Gene: ENSMUSG00000069171
AA Change: N86S

DomainStartEndE-ValueType
HOLI 71 231 5.16e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127137
AA Change: N76S

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133704
Gene: ENSMUSG00000069171
AA Change: N76S

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150498
AA Change: N76S

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118161
Gene: ENSMUSG00000069171
AA Change: N76S

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224798
AA Change: N86S

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor and transcriptional regulator. The encoded protein acts as a homodimer and binds to 5'-AGGTCA-3' repeats. Defects in this gene are a cause of Bosch-Boonstra optic atrophy syndrome (BBOAS). [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for a null allele die perinatally with axon guidance defects in all forebrain commissures. Homozygotes for another null allele show neonatal death, impaired cranial ganglion IX formation and axon guidance, increased cochlear HC and support cell number, and altered cortex regionalization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Nr2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Nr2f1 APN 13 78189833 missense probably damaging 1.00
IGL00553:Nr2f1 APN 13 78198242 missense probably damaging 1.00
IGL00821:Nr2f1 APN 13 78198114 unclassified probably benign
IGL02346:Nr2f1 APN 13 78195408 missense probably damaging 1.00
IGL02586:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02587:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02588:Nr2f1 APN 13 78195156 unclassified probably benign
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1865:Nr2f1 UTSW 13 78189926 missense probably damaging 1.00
R1959:Nr2f1 UTSW 13 78189816 missense probably damaging 1.00
R2284:Nr2f1 UTSW 13 78195462 missense probably damaging 1.00
R3861:Nr2f1 UTSW 13 78195675 nonsense probably null
R4542:Nr2f1 UTSW 13 78189821 missense probably damaging 1.00
R6248:Nr2f1 UTSW 13 78196492 intron probably benign
R6285:Nr2f1 UTSW 13 78195663 missense probably benign 0.01
R7305:Nr2f1 UTSW 13 78195179 missense probably damaging 1.00
R7496:Nr2f1 UTSW 13 78195242 missense probably damaging 1.00
R7653:Nr2f1 UTSW 13 78195597 missense probably benign 0.32
R7884:Nr2f1 UTSW 13 78189869 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGAAAGATGCGGATGTGGTCC -3'
(R):5'- GTATGCACTCACAAACGGGG -3'

Sequencing Primer
(F):5'- GATGTGGTCCATGAAGGCC -3'
(R):5'- CAAACGGGGATCCTCTCAATGG -3'
Posted On2020-01-23