Incidental Mutation 'R8030:Pkp2'
ID617919
Institutional Source Beutler Lab
Gene Symbol Pkp2
Ensembl Gene ENSMUSG00000041957
Gene Nameplakophilin 2
Synonyms1200008D14Rik, Pkp2l, 1200012P04Rik
Accession Numbers

NCBI RefSeq: NM_026163.2; MGI: 1914701

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location16213318-16272712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16246910 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 433 (M433L)
Ref Sequence ENSEMBL: ENSMUSP00000036890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039408]
Predicted Effect probably benign
Transcript: ENSMUST00000039408
AA Change: M433L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036890
Gene: ENSMUSG00000041957
AA Change: M433L

DomainStartEndE-ValueType
low complexity region 258 271 N/A INTRINSIC
ARM 342 382 7.5e-9 SMART
ARM 384 425 5.14e-7 SMART
Blast:ARM 426 481 2e-29 BLAST
ARM 484 530 8.76e-1 SMART
ARM 631 672 2.98e-3 SMART
Blast:ARM 677 718 2e-11 BLAST
Blast:ARM 720 763 5e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 3487374
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with impaired heart formation, hemopericardium, and hemoperitoneum. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Pkp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0014:Pkp2 UTSW 16 16240522 missense probably benign 0.08
R0131:Pkp2 UTSW 16 16240713 splice site probably benign
R0581:Pkp2 UTSW 16 16269783 splice site probably benign
R0722:Pkp2 UTSW 16 16247028 missense probably benign
R0882:Pkp2 UTSW 16 16269711 missense probably damaging 1.00
R0942:Pkp2 UTSW 16 16226030 missense probably benign
R1236:Pkp2 UTSW 16 16225902 missense probably benign
R1265:Pkp2 UTSW 16 16225304 missense probably benign 0.00
R1674:Pkp2 UTSW 16 16240558 missense possibly damaging 0.50
R1687:Pkp2 UTSW 16 16268709 critical splice donor site probably null
R1769:Pkp2 UTSW 16 16262697 missense probably damaging 1.00
R2094:Pkp2 UTSW 16 16246967 missense probably damaging 1.00
R4360:Pkp2 UTSW 16 16268682 missense probably benign 0.03
R4739:Pkp2 UTSW 16 16230724 missense probably damaging 0.99
R5162:Pkp2 UTSW 16 16260336 missense probably damaging 1.00
R5607:Pkp2 UTSW 16 16260375 missense probably damaging 0.98
R6334:Pkp2 UTSW 16 16226069 missense probably damaging 0.99
R6918:Pkp2 UTSW 16 16272218 missense probably damaging 1.00
R7274:Pkp2 UTSW 16 16246929 missense possibly damaging 0.92
R7408:Pkp2 UTSW 16 16261673 missense possibly damaging 0.50
R7698:Pkp2 UTSW 16 16240659 missense probably benign 0.01
R7788:Pkp2 UTSW 16 16225408 missense probably benign 0.01
R8056:Pkp2 UTSW 16 16213400 missense probably benign 0.28
R8161:Pkp2 UTSW 16 16213449 missense probably damaging 0.99
R8253:Pkp2 UTSW 16 16268542 missense probably damaging 1.00
Z1176:Pkp2 UTSW 16 16230700 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGAACCTGCATGATCTTGC -3'
(R):5'- TGGGTGCCCTATTTGATTACAC -3'

Sequencing Primer
(F):5'- CTTGAAGTTGATGGCCTTG -3'
(R):5'- TTGATTACACCTTTTATCTGAAGAGG -3'
Posted On2020-01-23