Incidental Mutation 'R8030:Dsc2'
ID 617923
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2b, Dsc2a
Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene? Non essential (E-score: 0.000) question?
Stock # R8030 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20030633-20059554 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20032274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20034665 nonsense probably null
R9005:Dsc2 UTSW 18 20038094 missense probably benign 0.00
R9017:Dsc2 UTSW 18 20043911 missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20034707 missense probably benign 0.00
R9396:Dsc2 UTSW 18 20041716 nonsense probably null
R9487:Dsc2 UTSW 18 20047219 missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20038148 missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On 2020-01-23