Incidental Mutation 'R8031:Itga8'
ID 617931
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 067469-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 12160297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 840 (D840E)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably benign
Transcript: ENSMUST00000028106
AA Change: D840E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: D840E

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,888,924 (GRCm39) probably null Het
Arhgdib A G 6: 136,901,274 (GRCm39) Y152H probably benign Het
Atxn10 T G 15: 85,277,594 (GRCm39) S354A probably benign Het
Cacng6 T C 7: 3,473,401 (GRCm39) V75A possibly damaging Het
Cdc23 A G 18: 34,784,741 (GRCm39) V7A unknown Het
Cdc40 T A 10: 40,728,512 (GRCm39) E157D probably benign Het
Defa25 T A 8: 21,575,253 (GRCm39) N77K probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Efcab3 T C 11: 104,772,295 (GRCm39) V2659A possibly damaging Het
Efcab6 T C 15: 83,867,699 (GRCm39) K260E possibly damaging Het
Eif4a3 T C 11: 119,179,731 (GRCm39) Y352C probably damaging Het
Erc2 A T 14: 27,733,649 (GRCm39) K566N probably damaging Het
Fam3b A C 16: 97,283,052 (GRCm39) Y74* probably null Het
Flg2 T A 3: 93,127,521 (GRCm39) S2144R unknown Het
Fmo4 G T 1: 162,626,421 (GRCm39) S375* probably null Het
Fsip2 A G 2: 82,817,235 (GRCm39) T4323A probably benign Het
Gm16503 A T 4: 147,625,767 (GRCm39) H87L unknown Het
Hes7 C T 11: 69,013,591 (GRCm39) A150V probably damaging Het
Hk1 T A 10: 62,132,478 (GRCm39) N190I probably benign Het
Il17rc A G 6: 113,459,782 (GRCm39) D576G probably damaging Het
Inhba T A 13: 16,200,860 (GRCm39) S141T possibly damaging Het
Kazn T C 4: 141,881,862 (GRCm39) E126G Het
Kcnk13 A G 12: 99,932,438 (GRCm39) Y78C probably damaging Het
Kcnt1 C A 2: 25,798,054 (GRCm39) probably benign Het
Krt42 G C 11: 100,155,865 (GRCm39) R294G possibly damaging Het
Myo9a A G 9: 59,687,374 (GRCm39) K160E probably benign Het
Nlrp1b T C 11: 71,107,747 (GRCm39) R585G probably benign Het
Ntrk2 T C 13: 59,022,193 (GRCm39) I416T probably benign Het
Or4c112 A T 2: 88,853,972 (GRCm39) I125N probably damaging Het
Or52h7 T A 7: 104,214,316 (GRCm39) I296N probably damaging Het
Or5k14 T C 16: 58,693,054 (GRCm39) N153S probably benign Het
Or8k33 G A 2: 86,384,447 (GRCm39) T7I probably damaging Het
P4ha3 A G 7: 99,941,905 (GRCm39) E106G probably damaging Het
Pcif1 A G 2: 164,728,442 (GRCm39) N233S probably damaging Het
Pgm2l1 C A 7: 99,921,625 (GRCm39) R619S probably damaging Het
Pkhd1l1 A G 15: 44,376,230 (GRCm39) Q964R probably damaging Het
Pla2g4a T A 1: 149,776,964 (GRCm39) I89F possibly damaging Het
Ppp1cc G A 5: 122,312,151 (GRCm39) A306T probably benign Het
Psmd4 T C 3: 94,943,203 (GRCm39) D67G probably damaging Het
Ptprt G A 2: 161,977,377 (GRCm39) T307I probably damaging Het
Rnf213 C A 11: 119,321,107 (GRCm39) C1188* probably null Het
Ror2 C T 13: 53,267,193 (GRCm39) C426Y probably damaging Het
Sacs C T 14: 61,441,640 (GRCm39) H1229Y probably damaging Het
Slc25a25 A T 2: 32,311,517 (GRCm39) L118Q probably damaging Het
Slc38a6 G A 12: 73,397,377 (GRCm39) A340T probably benign Het
Smarca5 A T 8: 81,431,311 (GRCm39) Y969N probably damaging Het
Sorbs1 C A 19: 40,314,933 (GRCm39) M626I probably benign Het
Spink5 T A 18: 44,143,303 (GRCm39) D753E probably benign Het
Taf1d T G 9: 15,221,695 (GRCm39) I226S probably damaging Het
Tmem225 A G 9: 40,060,689 (GRCm39) I83V possibly damaging Het
Top2b A G 14: 16,412,986 (GRCm38) D965G probably damaging Het
Traf3ip1 A G 1: 91,429,141 (GRCm39) K303E probably damaging Het
Ube2n C T 10: 95,377,244 (GRCm39) R70C probably benign Het
Ubl7 C T 9: 57,830,489 (GRCm39) P312S probably damaging Het
Vmn1r34 A T 6: 66,614,165 (GRCm39) M191K probably damaging Het
Vmn2r103 C T 17: 20,013,759 (GRCm39) H184Y probably benign Het
Vmn2r104 T C 17: 20,263,048 (GRCm39) I138V probably benign Het
Vmn2r49 T C 7: 9,720,408 (GRCm39) E361G possibly damaging Het
Vmn2r78 T C 7: 86,604,075 (GRCm39) L751P probably damaging Het
Zc3h13 T A 14: 75,568,070 (GRCm39) I1121N not run Het
Zfp235 T A 7: 23,841,114 (GRCm39) V511E probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGCCAAGACTACACTTGCTTAG -3'
(R):5'- TACCATGATTTCAGAGCGCC -3'

Sequencing Primer
(F):5'- CCCTTTAAAAAGAGAAATGGTCTGC -3'
(R):5'- ATGATTTCAGAGCGCCCCAGG -3'
Posted On 2020-01-23