Mutagenetix > Incidental Mutation

Incidental Mutation 'R8031:Itga8'

617931

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 12155486 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 840 (D840E)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably benign
Transcript: ENSMUST00000028106
AA Change: D840E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: D840E

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Eif4a3	T	C	11: 119,288,905	Y352C	probably damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Ntrk2	T	C	13: 58,874,379	I416T	probably benign	Het
Olfr1080	G	A	2: 86,554,103	T7I	probably damaging	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr177	T	C	16: 58,872,691	N153S	probably benign	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Psmd4	T	C	3: 95,035,892	D67G	probably damaging	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc25a25	A	T	2: 32,421,505	L118Q	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Sorbs1	C	A	19: 40,326,489	M626I	probably benign	Het
Spink5	T	A	18: 44,010,236	D753E	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGGCCAAGACTACACTTGCTTAG -3'
(R):5'- TACCATGATTTCAGAGCGCC -3'

Sequencing Primer
(F):5'- CCCTTTAAAAAGAGAAATGGTCTGC -3'
(R):5'- ATGATTTCAGAGCGCCCCAGG -3'

Posted On

2020-01-23