Mutagenetix > Incidental Mutations

Incidental Mutation 'R8031:Slc25a25'

617932

Institutional Source

Beutler Lab

Gene Symbol

Slc25a25

Ensembl Gene

ENSMUSG00000026819

Gene Name

solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25

Synonyms

1110030N17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32414487-32451445 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32421505 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 118 (L118Q)

Ref Sequence

ENSEMBL: ENSMUSP00000028160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028160] [ENSMUST00000052119] [ENSMUST00000113307] [ENSMUST00000113308] [ENSMUST00000113310] [ENSMUST00000136361] [ENSMUST00000153886]

AlphaFold

A2ASZ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028160
AA Change: L118Q

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000028160
Gene: ENSMUSG00000026819
AA Change: L118Q

Domain	Start	End	E-Value	Type
low complexity region	11	30	N/A	INTRINSIC
EFh	48	76	8.73e0	SMART
EFh	84	112	2.64e-1	SMART
EFh	115	143	1.36e0	SMART
Blast:EFh	151	191	1e-9	BLAST
Pfam:Mito_carr	227	320	1.7e-26	PFAM
Pfam:Mito_carr	321	413	6.4e-26	PFAM
Pfam:Mito_carr	418	512	9.9e-22	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052119
AA Change: L105Q

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000060581
Gene: ENSMUSG00000026819
AA Change: L105Q

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EFh	71	99	4.53e0	SMART
EFh	102	130	1.36e0	SMART
Blast:EFh	138	178	2e-9	BLAST
Pfam:Mito_carr	214	307	1.2e-26	PFAM
Pfam:Mito_carr	308	400	2.5e-27	PFAM
Pfam:Mito_carr	405	500	4.9e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113307
AA Change: L85Q

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108932
Gene: ENSMUSG00000026819
AA Change: L85Q

Domain	Start	End	E-Value	Type
EFh	51	79	9.51e0	SMART
EFh	82	110	1.36e0	SMART
EFh	118	146	8.82e1	SMART
Pfam:Mito_carr	182	275	1.1e-26	PFAM
Pfam:Mito_carr	276	368	2.2e-27	PFAM
Pfam:Mito_carr	373	468	4.4e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113308
AA Change: L105Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108933
Gene: ENSMUSG00000026819
AA Change: L105Q

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EFh	71	99	4.53e0	SMART
EFh	102	130	1.36e0	SMART
EFh	138	166	8.82e1	SMART
Pfam:Mito_carr	202	295	1.1e-26	PFAM
Pfam:Mito_carr	296	388	2.4e-27	PFAM
Pfam:Mito_carr	393	488	4.7e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113310
AA Change: L118Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108936
Gene: ENSMUSG00000026819
AA Change: L118Q

Domain	Start	End	E-Value	Type
low complexity region	11	30	N/A	INTRINSIC
EFh	48	76	8.73e0	SMART
EFh	84	112	2.64e-1	SMART
EFh	115	143	1.36e0	SMART
EFh	151	179	8.82e1	SMART
Pfam:Mito_carr	215	308	1.2e-26	PFAM
Pfam:Mito_carr	309	401	2.5e-27	PFAM
Pfam:Mito_carr	406	501	4.9e-21	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121932
Gene: ENSMUSG00000026819
AA Change: L69Q

Domain	Start	End	E-Value	Type
EFh	36	64	8.99e0	SMART
EFh	67	95	1.36e0	SMART
Blast:EFh	103	143	1e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000136361
AA Change: L70Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115617
Gene: ENSMUSG00000026819
AA Change: L70Q

Domain	Start	End	E-Value	Type
EFh	36	64	8.99e0	SMART
EFh	67	95	1.36e0	SMART
EFh	103	131	8.82e1	SMART
Pfam:Mito_carr	167	260	9.3e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153886

SMART Domains

Protein: ENSMUSP00000141486
Gene: ENSMUSG00000026819

Domain	Start	End	E-Value	Type
SCOP:d1exra_	1	38	1e-4	SMART
Blast:EFh	15	43	2e-13	BLAST
Pfam:Mito_carr	79	112	1.1e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced physical endurance and metabolic efficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Eif4a3	T	C	11: 119,288,905	Y352C	probably damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Itga8	G	T	2: 12,155,486	D840E	probably benign	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Ntrk2	T	C	13: 58,874,379	I416T	probably benign	Het
Olfr1080	G	A	2: 86,554,103	T7I	probably damaging	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr177	T	C	16: 58,872,691	N153S	probably benign	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Psmd4	T	C	3: 95,035,892	D67G	probably damaging	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Sorbs1	C	A	19: 40,326,489	M626I	probably benign	Het
Spink5	T	A	18: 44,010,236	D753E	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Slc25a25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Slc25a25	APN	2	32419160	missense	probably benign	0.04
IGL01431:Slc25a25	APN	2	32419091	missense	probably damaging	1.00
IGL02211:Slc25a25	APN	2	32417440	missense	probably damaging	1.00
IGL02393:Slc25a25	APN	2	32417843	missense	probably benign	0.40
R0385:Slc25a25	UTSW	2	32417822	missense	probably damaging	0.99
R1208:Slc25a25	UTSW	2	32417425	missense	probably benign	0.11
R1208:Slc25a25	UTSW	2	32417425	missense	probably benign	0.11
R1611:Slc25a25	UTSW	2	32420379	missense	probably damaging	1.00
R1960:Slc25a25	UTSW	2	32420651	splice site	probably null
R2405:Slc25a25	UTSW	2	32417719	splice site	probably null
R3749:Slc25a25	UTSW	2	32420380	missense	probably benign	0.21
R4446:Slc25a25	UTSW	2	32430609	missense	probably benign	0.00
R4815:Slc25a25	UTSW	2	32420410	missense	probably damaging	1.00
R5245:Slc25a25	UTSW	2	32421328	nonsense	probably null
R6884:Slc25a25	UTSW	2	32420662	missense	probably benign	0.34
R7144:Slc25a25	UTSW	2	32419166	missense	probably damaging	1.00
R7210:Slc25a25	UTSW	2	32420396	missense	possibly damaging	0.89
R7255:Slc25a25	UTSW	2	32421372	missense	possibly damaging	0.60
R7667:Slc25a25	UTSW	2	32451209	missense	probably benign	0.00
R7893:Slc25a25	UTSW	2	32451165	nonsense	probably null
R8550:Slc25a25	UTSW	2	32416193	missense	probably damaging	1.00
R9076:Slc25a25	UTSW	2	32419163	missense	probably damaging	1.00
R9255:Slc25a25	UTSW	2	32420379	missense	probably damaging	1.00
X0021:Slc25a25	UTSW	2	32421514	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTTCCGAGATCTTGACAC -3'
(R):5'- TAGGATTCCCATGGGCTGATAG -3'

Sequencing Primer
(F):5'- TTCCGAGATCTTGACACCCAGG -3'
(R):5'- CCTTAGAGATAGGACATCTTGGGTC -3'

Posted On

2020-01-23