Mutagenetix > Incidental Mutations

Incidental Mutation 'R8031:Olfr1080'

617934

Institutional Source

Beutler Lab

Gene Symbol

Olfr1080

Ensembl Gene

ENSMUSG00000110912

Gene Name

olfactory receptor 1080

Synonyms

MOR192-1, GA_x6K02T2Q125-48039418-48038477

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86552675-86558235 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 86554103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 7 (T7I)

Ref Sequence

ENSEMBL: ENSMUSP00000150502 (fasta)

AlphaFold

Q7TR67

Predicted Effect

probably damaging
Transcript: ENSMUST00000213185
AA Change: T7I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Eif4a3	T	C	11: 119,288,905	Y352C	probably damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Itga8	G	T	2: 12,155,486	D840E	probably benign	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Ntrk2	T	C	13: 58,874,379	I416T	probably benign	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr177	T	C	16: 58,872,691	N153S	probably benign	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Psmd4	T	C	3: 95,035,892	D67G	probably damaging	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc25a25	A	T	2: 32,421,505	L118Q	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Sorbs1	C	A	19: 40,326,489	M626I	probably benign	Het
Spink5	T	A	18: 44,010,236	D753E	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Olfr1080

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01937:Olfr1080	APN	2	86553449	missense	probably benign	0.34
IGL02169:Olfr1080	APN	2	86553882	missense	probably benign	0.39
IGL02234:Olfr1080	APN	2	86553266	missense	probably damaging	1.00
IGL02530:Olfr1080	APN	2	86553880	missense	possibly damaging	0.60
R0046:Olfr1080	UTSW	2	86553632	missense	probably damaging	1.00
R0360:Olfr1080	UTSW	2	86553779	missense	probably damaging	1.00
R0364:Olfr1080	UTSW	2	86553779	missense	probably damaging	1.00
R0377:Olfr1080	UTSW	2	86553583	missense	probably damaging	1.00
R1496:Olfr1080	UTSW	2	86553752	missense	probably damaging	1.00
R1609:Olfr1080	UTSW	2	86553605	missense	probably damaging	1.00
R1674:Olfr1080	UTSW	2	86553860	missense	probably damaging	0.96
R1816:Olfr1080	UTSW	2	86553667	nonsense	probably null
R2870:Olfr1080	UTSW	2	86553584	missense	possibly damaging	0.95
R2870:Olfr1080	UTSW	2	86553584	missense	possibly damaging	0.95
R4387:Olfr1080	UTSW	2	86553954	missense	probably damaging	1.00
R4915:Olfr1080	UTSW	2	86554055	missense	probably damaging	1.00
R4924:Olfr1080	UTSW	2	86553509	missense	probably damaging	1.00
R4987:Olfr1080	UTSW	2	86553235	splice site	probably null	0.10
R5774:Olfr1080	UTSW	2	86554007	missense	possibly damaging	0.68
R6305:Olfr1080	UTSW	2	86553495	missense	possibly damaging	0.91
R6829:Olfr1080	UTSW	2	86553269	nonsense	probably null
R7152:Olfr1080	UTSW	2	86553329	missense	probably benign	0.14
R7561:Olfr1080	UTSW	2	86553317	missense	probably benign	0.45
R7963:Olfr1080	UTSW	2	86553295	missense	possibly damaging	0.86
R8177:Olfr1080	UTSW	2	86553279	missense	noncoding transcript
R8349:Olfr1080	UTSW	2	86553636	missense	probably benign	0.22
R8449:Olfr1080	UTSW	2	86553636	missense	probably benign	0.22
R8490:Olfr1080	UTSW	2	86553683	missense	probably benign	0.06
R8787:Olfr1080	UTSW	2	86553953	missense	probably damaging	1.00
R8801:Olfr1080	UTSW	2	86553383	missense	probably benign	0.22
R8808:Olfr1080	UTSW	2	86553953	missense	probably damaging	1.00
R9035:Olfr1080	UTSW	2	86553677	missense	probably damaging	0.98
R9301:Olfr1080	UTSW	2	86553474	missense	possibly damaging	0.91
Z1088:Olfr1080	UTSW	2	86553966	missense	probably benign	0.40
Z1191:Olfr1080	UTSW	2	86554127	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCTGAGAAAGAAATACATTGGC -3'
(R):5'- GACAGTGTCAATTCATGTTTACATTG -3'

Sequencing Primer
(F):5'- GAAATACATTGGCGTCTGTAGC -3'
(R):5'- TGGAACTCACTCTTTAGACCAGG -3'

Posted On

2020-01-23