Mutagenetix > Incidental Mutations

Incidental Mutation 'R8031:Psmd4'

617939

Institutional Source

Beutler Lab

Gene Symbol

Psmd4

Ensembl Gene

ENSMUSG00000005625

Gene Name

proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Synonyms

Af1, multiubiquitin-chain-binding protein, Mcb1, angiocidin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95032694-95042614 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95035892 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 67 (D67G)

Ref Sequence

ENSEMBL: ENSMUSP00000071589 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071664] [ENSMUST00000107237] [ENSMUST00000117355] [ENSMUST00000140348]

AlphaFold

O35226

Predicted Effect

probably damaging
Transcript: ENSMUST00000071664
AA Change: D67G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071589
Gene: ENSMUSG00000005625
AA Change: D67G

Domain	Start	End	E-Value	Type
VWA	2	188	7.38e-12	SMART
low complexity region	189	201	N/A	INTRINSIC
UIM	211	230	2.04e0	SMART
UIM	285	304	1.49e-2	SMART
low complexity region	307	320	N/A	INTRINSIC
low complexity region	367	379	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107237
AA Change: D67G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102857
Gene: ENSMUSG00000005625
AA Change: D67G

Domain	Start	End	E-Value	Type
VWA	2	188	7.38e-12	SMART
low complexity region	189	201	N/A	INTRINSIC
UIM	211	230	2.04e0	SMART
UIM	282	301	1.49e-2	SMART
low complexity region	304	317	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117355
AA Change: D67G

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113554
Gene: ENSMUSG00000005625
AA Change: D67G

Domain	Start	End	E-Value	Type
VWA	2	188	7.38e-12	SMART
low complexity region	189	201	N/A	INTRINSIC
UIM	211	230	2.04e0	SMART
UIM	285	304	1.49e-2	SMART
low complexity region	307	320	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140348

SMART Domains

Protein: ENSMUSP00000114545
Gene: ENSMUSG00000005625

Domain	Start	End	E-Value	Type
Pfam:UIM	34	42	2.4e-3	PFAM
UIM	100	119	1.49e-2	SMART
low complexity region	122	135	N/A	INTRINSIC
low complexity region	182	194	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and abnormal embryogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Eif4a3	T	C	11: 119,288,905	Y352C	probably damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Itga8	G	T	2: 12,155,486	D840E	probably benign	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Ntrk2	T	C	13: 58,874,379	I416T	probably benign	Het
Olfr1080	G	A	2: 86,554,103	T7I	probably damaging	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr177	T	C	16: 58,872,691	N153S	probably benign	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc25a25	A	T	2: 32,421,505	L118Q	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Sorbs1	C	A	19: 40,326,489	M626I	probably benign	Het
Spink5	T	A	18: 44,010,236	D753E	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Psmd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02396:Psmd4	APN	3	95035910	missense	probably damaging	1.00
R0173:Psmd4	UTSW	3	95032923	missense	probably damaging	1.00
R1962:Psmd4	UTSW	3	95036701	missense	possibly damaging	0.89
R2907:Psmd4	UTSW	3	95033962	missense	probably damaging	0.99
R3781:Psmd4	UTSW	3	95036728	missense	probably benign	0.09
R3783:Psmd4	UTSW	3	95035251	missense	possibly damaging	0.85
R4902:Psmd4	UTSW	3	95035859	missense	probably damaging	0.98
R5090:Psmd4	UTSW	3	95035248	missense	possibly damaging	0.53
R9221:Psmd4	UTSW	3	95035293	missense	probably damaging	1.00
R9312:Psmd4	UTSW	3	95033418	missense	probably benign	0.00
R9428:Psmd4	UTSW	3	95033456	missense	probably benign	0.00
X0024:Psmd4	UTSW	3	95036717	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCACTGGTCCAGGTCCTC -3'
(R):5'- ACCGGGTTTTCATGTAGTCC -3'

Sequencing Primer
(F):5'- GGTCCAGGTCCTCTCGTCTTG -3'
(R):5'- GGTGAGTGCTCTTAACCACTGAAC -3'

Posted On

2020-01-23