Incidental Mutation 'R0659:Anxa6'
ID61794
Institutional Source Beutler Lab
Gene Symbol Anxa6
Ensembl Gene ENSMUSG00000018340
Gene Nameannexin A6
SynonymsAnxVI, Anx6, Cabm, Camb, Annexin VI
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0659 (G1)
Quality Score152
Status Validated
Chromosome11
Chromosomal Location54979108-55033445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54983347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 591 (V591A)
Ref Sequence ENSEMBL: ENSMUSP00000099788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102727] [ENSMUST00000108883]
Predicted Effect probably damaging
Transcript: ENSMUST00000102727
AA Change: V591A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099788
Gene: ENSMUSG00000018340
AA Change: V591A

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
ANX 535 587 7.77e-12 SMART
ANX 610 662 4.73e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108883
AA Change: V597A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104511
Gene: ENSMUSG00000018340
AA Change: V597A

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
low complexity region 517 528 N/A INTRINSIC
ANX 541 593 7.77e-12 SMART
ANX 616 668 4.73e-25 SMART
Meta Mutation Damage Score 0.1405 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele have normal immunological development but exhibit altered cardiomyocyte mechanics and intracellular calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Anxa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Anxa6 APN 11 54992363 missense probably damaging 1.00
IGL02450:Anxa6 APN 11 54994941 missense probably damaging 1.00
R0220:Anxa6 UTSW 11 54981762 intron probably null
R0374:Anxa6 UTSW 11 55005828 missense probably benign 0.02
R0599:Anxa6 UTSW 11 54979466 missense possibly damaging 0.92
R0924:Anxa6 UTSW 11 54994388 splice site probably null
R0930:Anxa6 UTSW 11 54994388 splice site probably null
R1005:Anxa6 UTSW 11 55001218 missense possibly damaging 0.89
R1435:Anxa6 UTSW 11 54991410 missense probably benign
R2314:Anxa6 UTSW 11 55011735 missense probably damaging 1.00
R2850:Anxa6 UTSW 11 55011026 missense possibly damaging 0.94
R4596:Anxa6 UTSW 11 54994583 splice site probably null
R5057:Anxa6 UTSW 11 55001236 missense possibly damaging 0.82
R5685:Anxa6 UTSW 11 54996370 missense probably benign
R5968:Anxa6 UTSW 11 54994341 missense probably damaging 1.00
R6145:Anxa6 UTSW 11 54994904 missense probably damaging 0.98
R6268:Anxa6 UTSW 11 54987077 splice site probably null
R6818:Anxa6 UTSW 11 54979500 missense probably benign
R6864:Anxa6 UTSW 11 54986185 missense probably benign
R7224:Anxa6 UTSW 11 54986167 missense probably damaging 1.00
R7595:Anxa6 UTSW 11 54985085 missense probably benign 0.00
R7740:Anxa6 UTSW 11 55007899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTACGTTTGGTCCAGAAGCAG -3'
(R):5'- CTCAGTCAGCCACAAGCTCCTTTAC -3'

Sequencing Primer
(F):5'- TTTGGTCCAGAAGCAGGATGC -3'
(R):5'- GGAGAGATTCAGCTCTCAGAC -3'
Posted On2013-07-30