Incidental Mutation 'R8031:Kazn'
ID 617940
Institutional Source Beutler Lab
Gene Symbol Kazn
Ensembl Gene ENSMUSG00000040606
Gene Name kazrin, periplakin interacting protein
Synonyms 9030409G11Rik, 2310007B04Rik
MMRRC Submission 067469-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R8031 (G1)
Quality Score 220.009
Status Validated
Chromosome 4
Chromosomal Location 141829701-142205056 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141881862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 126 (E126G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036476] [ENSMUST00000129032]
AlphaFold Q69ZS8
Predicted Effect probably damaging
Transcript: ENSMUST00000036476
AA Change: E196G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038835
Gene: ENSMUSG00000040606
AA Change: E196G

DomainStartEndE-ValueType
low complexity region 68 88 N/A INTRINSIC
SCOP:d1eq1a_ 113 248 8e-3 SMART
low complexity region 368 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129032
AA Change: E94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115897
Gene: ENSMUSG00000040606
AA Change: E94G

DomainStartEndE-ValueType
coiled coil region 7 148 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116071
Gene: ENSMUSG00000040606
AA Change: E126G

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
SAM 367 435 6.32e-6 SMART
SAM 444 512 4.17e-6 SMART
SAM 533 602 3.37e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000133972
Gene: ENSMUSG00000040606
AA Change: E126G

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134498
Gene: ENSMUSG00000040606
AA Change: E20G

DomainStartEndE-ValueType
coiled coil region 1 74 N/A INTRINSIC
low complexity region 194 201 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134631
Gene: ENSMUSG00000040606
AA Change: E126G

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 300 307 N/A INTRINSIC
Meta Mutation Damage Score 0.2411 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile and grossly normal with no obvious defects in skin development or homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,888,924 (GRCm39) probably null Het
Arhgdib A G 6: 136,901,274 (GRCm39) Y152H probably benign Het
Atxn10 T G 15: 85,277,594 (GRCm39) S354A probably benign Het
Cacng6 T C 7: 3,473,401 (GRCm39) V75A possibly damaging Het
Cdc23 A G 18: 34,784,741 (GRCm39) V7A unknown Het
Cdc40 T A 10: 40,728,512 (GRCm39) E157D probably benign Het
Defa25 T A 8: 21,575,253 (GRCm39) N77K probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Efcab3 T C 11: 104,772,295 (GRCm39) V2659A possibly damaging Het
Efcab6 T C 15: 83,867,699 (GRCm39) K260E possibly damaging Het
Eif4a3 T C 11: 119,179,731 (GRCm39) Y352C probably damaging Het
Erc2 A T 14: 27,733,649 (GRCm39) K566N probably damaging Het
Fam3b A C 16: 97,283,052 (GRCm39) Y74* probably null Het
Flg2 T A 3: 93,127,521 (GRCm39) S2144R unknown Het
Fmo4 G T 1: 162,626,421 (GRCm39) S375* probably null Het
Fsip2 A G 2: 82,817,235 (GRCm39) T4323A probably benign Het
Gm16503 A T 4: 147,625,767 (GRCm39) H87L unknown Het
Hes7 C T 11: 69,013,591 (GRCm39) A150V probably damaging Het
Hk1 T A 10: 62,132,478 (GRCm39) N190I probably benign Het
Il17rc A G 6: 113,459,782 (GRCm39) D576G probably damaging Het
Inhba T A 13: 16,200,860 (GRCm39) S141T possibly damaging Het
Itga8 G T 2: 12,160,297 (GRCm39) D840E probably benign Het
Kcnk13 A G 12: 99,932,438 (GRCm39) Y78C probably damaging Het
Kcnt1 C A 2: 25,798,054 (GRCm39) probably benign Het
Krt42 G C 11: 100,155,865 (GRCm39) R294G possibly damaging Het
Myo9a A G 9: 59,687,374 (GRCm39) K160E probably benign Het
Nlrp1b T C 11: 71,107,747 (GRCm39) R585G probably benign Het
Ntrk2 T C 13: 59,022,193 (GRCm39) I416T probably benign Het
Or4c112 A T 2: 88,853,972 (GRCm39) I125N probably damaging Het
Or52h7 T A 7: 104,214,316 (GRCm39) I296N probably damaging Het
Or5k14 T C 16: 58,693,054 (GRCm39) N153S probably benign Het
Or8k33 G A 2: 86,384,447 (GRCm39) T7I probably damaging Het
P4ha3 A G 7: 99,941,905 (GRCm39) E106G probably damaging Het
Pcif1 A G 2: 164,728,442 (GRCm39) N233S probably damaging Het
Pgm2l1 C A 7: 99,921,625 (GRCm39) R619S probably damaging Het
Pkhd1l1 A G 15: 44,376,230 (GRCm39) Q964R probably damaging Het
Pla2g4a T A 1: 149,776,964 (GRCm39) I89F possibly damaging Het
Ppp1cc G A 5: 122,312,151 (GRCm39) A306T probably benign Het
Psmd4 T C 3: 94,943,203 (GRCm39) D67G probably damaging Het
Ptprt G A 2: 161,977,377 (GRCm39) T307I probably damaging Het
Rnf213 C A 11: 119,321,107 (GRCm39) C1188* probably null Het
Ror2 C T 13: 53,267,193 (GRCm39) C426Y probably damaging Het
Sacs C T 14: 61,441,640 (GRCm39) H1229Y probably damaging Het
Slc25a25 A T 2: 32,311,517 (GRCm39) L118Q probably damaging Het
Slc38a6 G A 12: 73,397,377 (GRCm39) A340T probably benign Het
Smarca5 A T 8: 81,431,311 (GRCm39) Y969N probably damaging Het
Sorbs1 C A 19: 40,314,933 (GRCm39) M626I probably benign Het
Spink5 T A 18: 44,143,303 (GRCm39) D753E probably benign Het
Taf1d T G 9: 15,221,695 (GRCm39) I226S probably damaging Het
Tmem225 A G 9: 40,060,689 (GRCm39) I83V possibly damaging Het
Top2b A G 14: 16,412,986 (GRCm38) D965G probably damaging Het
Traf3ip1 A G 1: 91,429,141 (GRCm39) K303E probably damaging Het
Ube2n C T 10: 95,377,244 (GRCm39) R70C probably benign Het
Ubl7 C T 9: 57,830,489 (GRCm39) P312S probably damaging Het
Vmn1r34 A T 6: 66,614,165 (GRCm39) M191K probably damaging Het
Vmn2r103 C T 17: 20,013,759 (GRCm39) H184Y probably benign Het
Vmn2r104 T C 17: 20,263,048 (GRCm39) I138V probably benign Het
Vmn2r49 T C 7: 9,720,408 (GRCm39) E361G possibly damaging Het
Vmn2r78 T C 7: 86,604,075 (GRCm39) L751P probably damaging Het
Zc3h13 T A 14: 75,568,070 (GRCm39) I1121N not run Het
Zfp235 T A 7: 23,841,114 (GRCm39) V511E probably benign Het
Other mutations in Kazn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Kazn APN 4 141,886,354 (GRCm39) critical splice donor site probably null
IGL01959:Kazn APN 4 141,878,195 (GRCm39) missense probably damaging 1.00
IGL02237:Kazn APN 4 141,874,410 (GRCm39) missense probably benign 0.31
IGL02351:Kazn APN 4 141,874,327 (GRCm39) critical splice donor site probably null
IGL02358:Kazn APN 4 141,874,327 (GRCm39) critical splice donor site probably null
R1173:Kazn UTSW 4 141,886,349 (GRCm39) splice site probably benign
R2206:Kazn UTSW 4 141,845,603 (GRCm39) splice site probably null
R3406:Kazn UTSW 4 141,966,506 (GRCm39) start gained probably benign
R4007:Kazn UTSW 4 141,834,203 (GRCm39) missense unknown
R4050:Kazn UTSW 4 141,834,215 (GRCm39) missense unknown
R4598:Kazn UTSW 4 141,937,403 (GRCm39) missense possibly damaging 0.53
R4606:Kazn UTSW 4 141,845,599 (GRCm39) splice site probably null
R4631:Kazn UTSW 4 141,845,471 (GRCm39) unclassified probably benign
R4866:Kazn UTSW 4 141,832,216 (GRCm39) missense unknown
R5050:Kazn UTSW 4 141,845,514 (GRCm39) unclassified probably benign
R5052:Kazn UTSW 4 141,845,514 (GRCm39) unclassified probably benign
R5054:Kazn UTSW 4 141,835,957 (GRCm39) missense unknown
R5758:Kazn UTSW 4 141,868,982 (GRCm39) critical splice donor site probably null
R6152:Kazn UTSW 4 141,836,598 (GRCm39) missense unknown
R6284:Kazn UTSW 4 141,844,508 (GRCm39) missense probably benign 0.04
R7289:Kazn UTSW 4 141,844,486 (GRCm39) missense
R7414:Kazn UTSW 4 141,836,649 (GRCm39) missense
R7663:Kazn UTSW 4 141,832,209 (GRCm39) missense
R7814:Kazn UTSW 4 141,937,481 (GRCm39) missense unknown
R8184:Kazn UTSW 4 141,845,441 (GRCm39) missense probably benign 0.04
R8315:Kazn UTSW 4 141,869,002 (GRCm39) missense
R8779:Kazn UTSW 4 141,881,856 (GRCm39) missense
R8990:Kazn UTSW 4 141,868,947 (GRCm39) missense probably damaging 1.00
R9491:Kazn UTSW 4 141,845,436 (GRCm39) missense
Z1177:Kazn UTSW 4 141,881,815 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AACTCAGGAGTGTCACACAGC -3'
(R):5'- GTGACCACCCCATAGCTTTC -3'

Sequencing Primer
(F):5'- AGCCTCCTTCTCCCTCAGGG -3'
(R):5'- TTTCCCACCTCACACCAGGG -3'
Posted On 2020-01-23