Incidental Mutation 'R8031:Ppp1cc'
ID617942
Institutional Source Beutler Lab
Gene Symbol Ppp1cc
Ensembl Gene ENSMUSG00000004455
Gene Nameprotein phosphatase 1, catalytic subunit, gamma isoform
SynonymsPP1C gamma, PP1C gamma 2, PP1C gamma 1, PP1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8031 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122158278-122175273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122174088 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 306 (A306T)
Ref Sequence ENSEMBL: ENSMUSP00000099587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086294] [ENSMUST00000102528] [ENSMUST00000128309] [ENSMUST00000132555]
Predicted Effect probably benign
Transcript: ENSMUST00000086294
AA Change: A306T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083474
Gene: ENSMUSG00000004455
AA Change: A306T

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102528
AA Change: A306T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099587
Gene: ENSMUSG00000004455
AA Change: A306T

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128309
SMART Domains Protein: ENSMUSP00000142415
Gene: ENSMUSG00000004455

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132555
SMART Domains Protein: ENSMUSP00000143509
Gene: ENSMUSG00000004455

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133568
Predicted Effect probably benign
Transcript: ENSMUST00000134719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142562
Predicted Effect probably benign
Transcript: ENSMUST00000151184
Predicted Effect
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to severely impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Ppp1cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02747:Ppp1cc APN 5 122174073 missense probably benign 0.02
R0524:Ppp1cc UTSW 5 122172770 nonsense probably null
R1223:Ppp1cc UTSW 5 122168214 missense probably damaging 1.00
R2926:Ppp1cc UTSW 5 122174088 missense probably benign
R2999:Ppp1cc UTSW 5 122174088 missense probably benign
R4133:Ppp1cc UTSW 5 122168226 missense probably benign 0.08
Z1088:Ppp1cc UTSW 5 122172753 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATGGCACTTCTCCACCAAAATG -3'
(R):5'- AGCAAGTGCCAGCAGTAATC -3'

Sequencing Primer
(F):5'- AATGCTCAGGGACCAGTCG -3'
(R):5'- CAAGTGCCAGCAGTAATCAAATG -3'
Posted On2020-01-23