Incidental Mutation 'R8031:Arhgdib'
ID 617945
Institutional Source Beutler Lab
Gene Symbol Arhgdib
Ensembl Gene ENSMUSG00000030220
Gene Name Rho, GDP dissociation inhibitor (GDI) beta
Synonyms Ly-GDI, D4, Gdid4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 136923655-136941899 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136924276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 152 (Y152H)
Ref Sequence ENSEMBL: ENSMUSP00000032344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032343] [ENSMUST00000032344] [ENSMUST00000111891] [ENSMUST00000111892] [ENSMUST00000204627] [ENSMUST00000204934]
AlphaFold Q61599
Predicted Effect probably benign
Transcript: ENSMUST00000032343
SMART Domains Protein: ENSMUSP00000032343
Gene: ENSMUSG00000030219

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:Thioredoxin_6 64 251 2.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032344
AA Change: Y152H

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032344
Gene: ENSMUSG00000030220
AA Change: Y152H

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 197 4e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111891
AA Change: Y152H

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107522
Gene: ENSMUSG00000030220
AA Change: Y152H

DomainStartEndE-ValueType
Pfam:Rho_GDI 6 197 5.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111892
AA Change: Y152H

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107523
Gene: ENSMUSG00000030220
AA Change: Y152H

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 197 4e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204627
SMART Domains Protein: ENSMUSP00000145191
Gene: ENSMUSG00000064330

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 74 1.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204934
AA Change: Y69H

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000145103
Gene: ENSMUSG00000030220
AA Change: Y69H

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 89 1.5e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Rho guanine nucleotide dissociation inhibitor (GDI) family. This gene is expressed at high levels in hematopoietic cells. This protein is cytosolic, and dissociation of Rho from this protein is required for membrane association and activation of Rho by Guanine Nucleotide Exchange Factors (GEFs). C-terminal truncations of this gene product have been reported to promote metastasis. Multiple transcript variants and protein isoforms exist. [provided by RefSeq, Aug 2014]
PHENOTYPE: A homozygous null mutation results in mice that are viable and fertile. Immune responses are similar to controls in mice, but in vitro analysis demonstrated an increased B cell proliferative response upon lectin stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Arhgdib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Arhgdib APN 6 136933624 missense probably damaging 1.00
IGL01712:Arhgdib APN 6 136924197 missense probably damaging 1.00
IGL02589:Arhgdib APN 6 136933578 intron probably benign
IGL02648:Arhgdib APN 6 136933649 missense probably damaging 1.00
IGL02682:Arhgdib APN 6 136924168 missense probably damaging 1.00
IGL03381:Arhgdib APN 6 136932316 missense probably benign 0.30
K7371:Arhgdib UTSW 6 136932299 splice site probably null
PIT4810001:Arhgdib UTSW 6 136924164 missense probably damaging 1.00
R0270:Arhgdib UTSW 6 136926734 missense probably damaging 1.00
R1755:Arhgdib UTSW 6 136929614 nonsense probably null
R4289:Arhgdib UTSW 6 136924158 missense probably benign 0.02
R5927:Arhgdib UTSW 6 136924138 missense probably damaging 1.00
R6364:Arhgdib UTSW 6 136932255 splice site probably null
R8010:Arhgdib UTSW 6 136926722 missense probably damaging 1.00
Z1088:Arhgdib UTSW 6 136933618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGGAGAACTCTTCTGGTG -3'
(R):5'- AATTGTGCACACCTGGCTTAG -3'

Sequencing Primer
(F):5'- AACTCTTCTGGTGGGTGAGGAAG -3'
(R):5'- GCACACCTGGCTTAGTTATAAAAAGG -3'
Posted On 2020-01-23