Incidental Mutation 'R8031:Cacng6'
ID 617946
Institutional Source Beutler Lab
Gene Symbol Cacng6
Ensembl Gene ENSMUSG00000078815
Gene Name calcium channel, voltage-dependent, gamma subunit 6
Synonyms 2310033H20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_133183; MGI: 1859168
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 3424195-3435667 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3424885 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000138622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108647] [ENSMUST00000183200]
AlphaFold Q8VHW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000108647
AA Change: V75A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104287
Gene: ENSMUSG00000078815
AA Change: V75A

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:Claudin_2 47 240 1.8e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183200
AA Change: V75A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138622
Gene: ENSMUSG00000078815
AA Change: V75A

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:Claudin_2 47 240 7e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Cacng6
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Cacng6 UTSW 7 3430513 critical splice donor site probably null
R0019:Cacng6 UTSW 7 3431868 missense possibly damaging 0.95
R0207:Cacng6 UTSW 7 3425004 splice site probably benign
R0558:Cacng6 UTSW 7 3434808 nonsense probably null
R0987:Cacng6 UTSW 7 3430504 missense probably damaging 1.00
R1346:Cacng6 UTSW 7 3434922 missense possibly damaging 0.90
R1470:Cacng6 UTSW 7 3424888 missense probably damaging 1.00
R1470:Cacng6 UTSW 7 3424888 missense probably damaging 1.00
R2116:Cacng6 UTSW 7 3430504 missense probably damaging 1.00
R5327:Cacng6 UTSW 7 3434860 missense probably damaging 0.99
R6383:Cacng6 UTSW 7 3424993 critical splice donor site probably null
R7935:Cacng6 UTSW 7 3424868 missense possibly damaging 0.93
R8884:Cacng6 UTSW 7 3430468 missense probably damaging 1.00
R9160:Cacng6 UTSW 7 3434890 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCATGCAAGAGGAAGACCGAC -3'
(R):5'- TGGGCACAAACATTCTTGGG -3'

Sequencing Primer
(F):5'- GACGCCGGACAGCTGTG -3'
(R):5'- AGTTTCCCCCAGACAAAAGTTTC -3'
Posted On 2020-01-23