Incidental Mutation 'R8031:Olfr652'
ID 617952
Institutional Source Beutler Lab
Gene Symbol Olfr652
Ensembl Gene ENSMUSG00000073927
Gene Name olfactory receptor 652
Synonyms MOR31-8, GA_x6K02T2PBJ9-7191524-7192471
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 104560901-104568634 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104565109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 296 (I296N)
Ref Sequence ENSEMBL: ENSMUSP00000149718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098175] [ENSMUST00000215410] [ENSMUST00000216131] [ENSMUST00000219111]
AlphaFold B9EHE6
Predicted Effect probably damaging
Transcript: ENSMUST00000098175
AA Change: I296N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095777
Gene: ENSMUSG00000073927
AA Change: I296N

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:7tm_4 36 315 2.6e-105 PFAM
Pfam:7TM_GPCR_Srsx 40 312 6.9e-9 PFAM
Pfam:7tm_1 46 297 4.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215410
AA Change: I296N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216131
AA Change: I296N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000219111
AA Change: I296N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Olfr652
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr652 APN 7 104564829 missense probably damaging 1.00
IGL01620:Olfr652 APN 7 104565013 missense probably damaging 0.97
IGL01712:Olfr652 APN 7 104565019 missense probably benign
IGL02211:Olfr652 APN 7 104565126 nonsense probably null
IGL03328:Olfr652 APN 7 104564470 missense probably damaging 1.00
K7894:Olfr652 UTSW 7 104564532 missense probably benign 0.12
R0138:Olfr652 UTSW 7 104565003 missense probably benign
R0632:Olfr652 UTSW 7 104564337 missense probably benign 0.00
R1457:Olfr652 UTSW 7 104565071 missense probably damaging 1.00
R1494:Olfr652 UTSW 7 104564831 nonsense probably null
R1879:Olfr652 UTSW 7 104564911 missense possibly damaging 0.93
R2188:Olfr652 UTSW 7 104564676 missense probably benign 0.00
R2323:Olfr652 UTSW 7 104564619 missense probably benign 0.01
R3862:Olfr652 UTSW 7 104564938 missense probably benign 0.01
R3908:Olfr652 UTSW 7 104564641 missense probably benign 0.01
R4942:Olfr652 UTSW 7 104565005 missense probably benign 0.00
R5443:Olfr652 UTSW 7 104564376 missense probably benign 0.14
R5572:Olfr652 UTSW 7 104564994 missense probably benign 0.08
R6045:Olfr652 UTSW 7 104564767 missense probably benign 0.42
R6973:Olfr652 UTSW 7 104564976 missense probably benign 0.42
R7147:Olfr652 UTSW 7 104564066 start gained probably benign
R7349:Olfr652 UTSW 7 104564650 missense probably benign
R7968:Olfr652 UTSW 7 104564650 missense probably benign 0.01
R8129:Olfr652 UTSW 7 104564377 missense probably benign 0.07
R8198:Olfr652 UTSW 7 104564933 missense probably benign 0.01
R8296:Olfr652 UTSW 7 104564386 missense probably benign
R8345:Olfr652 UTSW 7 104564224 start codon destroyed probably null 0.08
R8475:Olfr652 UTSW 7 104564859 missense probably benign
R8875:Olfr652 UTSW 7 104564463 missense probably benign 0.00
R8881:Olfr652 UTSW 7 104564412 missense possibly damaging 0.58
R8927:Olfr652 UTSW 7 104565022 missense probably damaging 1.00
R8928:Olfr652 UTSW 7 104565022 missense probably damaging 1.00
X0024:Olfr652 UTSW 7 104564250 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAACCTTCCCTCCCAGGATG -3'
(R):5'- AATGGGTTCAGCTTCCACATTTTC -3'

Sequencing Primer
(F):5'- GGATGCCCGCAAGAAAGCC -3'
(R):5'- GCTTCCACATTTTCTATCATTCAGAG -3'
Posted On 2020-01-23