Incidental Mutation 'R8031:Hes7'
ID 617962
Institutional Source Beutler Lab
Gene Symbol Hes7
Ensembl Gene ENSMUSG00000023781
Gene Name hes family bHLH transcription factor 7
Synonyms bHLHb37
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69120404-69124055 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 69122765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 150 (A150V)
Ref Sequence ENSEMBL: ENSMUSP00000024543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021268] [ENSMUST00000024543] [ENSMUST00000175661] [ENSMUST00000180487]
AlphaFold Q8BKT2
Predicted Effect probably benign
Transcript: ENSMUST00000021268
SMART Domains Protein: ENSMUSP00000021268
Gene: ENSMUSG00000020892

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 249 697 3.4e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000024543
AA Change: A150V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024543
Gene: ENSMUSG00000023781
AA Change: A150V

DomainStartEndE-ValueType
HLH 18 75 2.01e-5 SMART
low complexity region 137 152 N/A INTRINSIC
low complexity region 188 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175661
SMART Domains Protein: ENSMUSP00000134814
Gene: ENSMUSG00000020892

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 245 377 7.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180487
SMART Domains Protein: ENSMUSP00000137894
Gene: ENSMUSG00000097386

DomainStartEndE-ValueType
low complexity region 31 40 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hairy and enhancer of split family of bHLH transcription factors. The mouse ortholog of this gene is regulated by Notch signaling. The protein functions as a transcriptional repressor, and is implicated in correct patterning of the axial skeleton. A mutation in this gene has been shown to result in spondylocostal dysostosis. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted somite formation leading to skeletal defects including short trunk and tail, reduced numbers of ribs, and deformed and fused vertebrae, and neonatal death. Some heterozygotes have tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Hes7
AlleleSourceChrCoordTypePredicted EffectPPH Score
entrapped UTSW 11 69121526 missense unknown
R5719:Hes7 UTSW 11 69121589 missense probably damaging 0.99
R7721:Hes7 UTSW 11 69121526 missense unknown
R9025:Hes7 UTSW 11 69122956 missense probably benign
Z1186:Hes7 UTSW 11 69122956 missense probably benign
Z1187:Hes7 UTSW 11 69122956 missense probably benign
Z1188:Hes7 UTSW 11 69122956 missense probably benign
Z1189:Hes7 UTSW 11 69122956 missense probably benign
Z1190:Hes7 UTSW 11 69122956 missense probably benign
Z1191:Hes7 UTSW 11 69122956 missense probably benign
Z1192:Hes7 UTSW 11 69122956 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACCATGGCGAGGTTAATAACACC -3'
(R):5'- AGGGCCAAGGTCTCCAAAAC -3'

Sequencing Primer
(F):5'- GTTAATAACACCCGCGCGTGTC -3'
(R):5'- CAAGGTCTCCAAAACGCGGG -3'
Posted On 2020-01-23