Incidental Mutation 'R8031:Nlrp1b'
ID 617963
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene Name NLR family, pyrin domain containing 1B
Synonyms Nalp1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 71153102-71230733 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71216921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 585 (R585G)
Ref Sequence ENSEMBL: ENSMUSP00000104156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108516] [ENSMUST00000136493]
AlphaFold A1Z198
Predicted Effect probably benign
Transcript: ENSMUST00000094046
AA Change: R585G

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390
AA Change: R585G

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108516
AA Change: R585G

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390
AA Change: R585G

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
AA Change: R585G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390
AA Change: R585G

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
Thorn UTSW 11 71156300 splice site probably benign
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7349:Nlrp1b UTSW 11 71182117 missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71168839 missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R8087:Nlrp1b UTSW 11 71172071 missense probably benign 0.04
R8164:Nlrp1b UTSW 11 71228417 missense possibly damaging 0.78
R8378:Nlrp1b UTSW 11 71161719 missense possibly damaging 0.95
R8405:Nlrp1b UTSW 11 71182530 missense possibly damaging 0.66
R8441:Nlrp1b UTSW 11 71182378 missense probably damaging 1.00
R8792:Nlrp1b UTSW 11 71160093 missense probably benign 0.02
R8898:Nlrp1b UTSW 11 71182462 missense probably damaging 1.00
R8953:Nlrp1b UTSW 11 71161806 missense probably damaging 0.96
R8963:Nlrp1b UTSW 11 71217832 missense probably damaging 1.00
R9145:Nlrp1b UTSW 11 71218367 missense probably benign
R9184:Nlrp1b UTSW 11 71181241 missense probably damaging 1.00
R9286:Nlrp1b UTSW 11 71169747 missense probably benign
R9322:Nlrp1b UTSW 11 71217292 missense probably benign 0.12
R9453:Nlrp1b UTSW 11 71182087 missense probably damaging 0.98
Z1176:Nlrp1b UTSW 11 71182270 missense probably damaging 1.00
Z1177:Nlrp1b UTSW 11 71181299 nonsense probably null
Z1177:Nlrp1b UTSW 11 71217224 missense probably benign 0.03
Z1186:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1186:Nlrp1b UTSW 11 71181713 missense probably benign
Z1186:Nlrp1b UTSW 11 71181799 missense probably benign
Z1186:Nlrp1b UTSW 11 71182309 missense probably benign
Z1186:Nlrp1b UTSW 11 71182322 missense probably benign
Z1186:Nlrp1b UTSW 11 71182440 missense probably benign
Z1186:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1186:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1186:Nlrp1b UTSW 11 71182552 missense probably benign
Z1186:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1186:Nlrp1b UTSW 11 71182677 missense probably benign
Z1187:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1187:Nlrp1b UTSW 11 71181713 missense probably benign
Z1187:Nlrp1b UTSW 11 71181799 missense probably benign
Z1187:Nlrp1b UTSW 11 71182322 missense probably benign
Z1187:Nlrp1b UTSW 11 71182440 missense probably benign
Z1187:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1187:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1187:Nlrp1b UTSW 11 71182552 missense probably benign
Z1187:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1187:Nlrp1b UTSW 11 71182677 missense probably benign
Z1188:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1188:Nlrp1b UTSW 11 71181713 missense probably benign
Z1188:Nlrp1b UTSW 11 71181799 missense probably benign
Z1188:Nlrp1b UTSW 11 71182309 missense probably benign
Z1188:Nlrp1b UTSW 11 71182322 missense probably benign
Z1188:Nlrp1b UTSW 11 71182440 missense probably benign
Z1188:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1188:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1188:Nlrp1b UTSW 11 71182552 missense probably benign
Z1188:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1188:Nlrp1b UTSW 11 71182677 missense probably benign
Z1189:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1189:Nlrp1b UTSW 11 71181713 missense probably benign
Z1189:Nlrp1b UTSW 11 71181799 missense probably benign
Z1189:Nlrp1b UTSW 11 71182309 missense probably benign
Z1189:Nlrp1b UTSW 11 71182322 missense probably benign
Z1189:Nlrp1b UTSW 11 71182440 missense probably benign
Z1189:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71182552 missense probably benign
Z1189:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1189:Nlrp1b UTSW 11 71182677 missense probably benign
Z1190:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1190:Nlrp1b UTSW 11 71181713 missense probably benign
Z1190:Nlrp1b UTSW 11 71181799 missense probably benign
Z1190:Nlrp1b UTSW 11 71182309 missense probably benign
Z1190:Nlrp1b UTSW 11 71182322 missense probably benign
Z1190:Nlrp1b UTSW 11 71182440 missense probably benign
Z1190:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1190:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1190:Nlrp1b UTSW 11 71182552 missense probably benign
Z1190:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1190:Nlrp1b UTSW 11 71182677 missense probably benign
Z1191:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1191:Nlrp1b UTSW 11 71181713 missense probably benign
Z1191:Nlrp1b UTSW 11 71181799 missense probably benign
Z1191:Nlrp1b UTSW 11 71182309 missense probably benign
Z1191:Nlrp1b UTSW 11 71182322 missense probably benign
Z1191:Nlrp1b UTSW 11 71182440 missense probably benign
Z1191:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1191:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1191:Nlrp1b UTSW 11 71182552 missense probably benign
Z1191:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1191:Nlrp1b UTSW 11 71182677 missense probably benign
Z1192:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1192:Nlrp1b UTSW 11 71181799 missense probably benign
Z1192:Nlrp1b UTSW 11 71182322 missense probably benign
Z1192:Nlrp1b UTSW 11 71182440 missense probably benign
Z1192:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71182552 missense probably benign
Z1192:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1192:Nlrp1b UTSW 11 71182677 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCCATCCTATGATCAAGC -3'
(R):5'- AAGTCAGGAAGAGGTGCTCCTG -3'

Sequencing Primer
(F):5'- GTAGTTAAATGTCGACAGTGACCTG -3'
(R):5'- AAGAGGTGCTCCTGACATATGTG -3'
Posted On 2020-01-23