Incidental Mutation 'R8031:Krt42'
ID 617964
Institutional Source Beutler Lab
Gene Symbol Krt42
Ensembl Gene ENSMUSG00000053654
Gene Name keratin 42
Synonyms Ka22, ecat6, K17n, 2410039E07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 100262882-100269871 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 100265039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 294 (R294G)
Ref Sequence ENSEMBL: ENSMUSP00000017270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017270] [ENSMUST00000080893]
AlphaFold Q6IFX2
Predicted Effect possibly damaging
Transcript: ENSMUST00000017270
AA Change: R294G

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000017270
Gene: ENSMUSG00000053654
AA Change: R294G

DomainStartEndE-ValueType
low complexity region 62 84 N/A INTRINSIC
Filament 93 404 5.58e-184 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080893
SMART Domains Protein: ENSMUSP00000079699
Gene: ENSMUSG00000035557

DomainStartEndE-ValueType
Filament 83 394 9.36e-177 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Krt42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Krt42 APN 11 100263341 missense possibly damaging 0.93
PIT4377001:Krt42 UTSW 11 100263105 missense probably damaging 0.97
R0135:Krt42 UTSW 11 100263159 missense possibly damaging 0.95
R0535:Krt42 UTSW 11 100264586 missense probably damaging 1.00
R1169:Krt42 UTSW 11 100263345 critical splice acceptor site probably null
R1456:Krt42 UTSW 11 100269609 missense probably benign 0.00
R1456:Krt42 UTSW 11 100269610 missense probably benign 0.04
R1913:Krt42 UTSW 11 100267249 missense possibly damaging 0.78
R4655:Krt42 UTSW 11 100269845 missense probably damaging 0.99
R5527:Krt42 UTSW 11 100263295 unclassified probably benign
R6049:Krt42 UTSW 11 100267060 missense probably damaging 1.00
R6901:Krt42 UTSW 11 100269716 missense probably benign 0.00
R7748:Krt42 UTSW 11 100266966 missense probably damaging 1.00
R7979:Krt42 UTSW 11 100265039 missense possibly damaging 0.67
R8030:Krt42 UTSW 11 100265039 missense possibly damaging 0.67
R8063:Krt42 UTSW 11 100265039 missense possibly damaging 0.67
R8108:Krt42 UTSW 11 100266957 missense probably benign 0.01
R9040:Krt42 UTSW 11 100267033 missense probably damaging 1.00
R9211:Krt42 UTSW 11 100265041 missense possibly damaging 0.52
R9265:Krt42 UTSW 11 100266982 missense probably damaging 1.00
Z1177:Krt42 UTSW 11 100267068 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGGTTGCTTCTAGTCATCC -3'
(R):5'- GTCCCTTGCAGGTTCTAGATAC -3'

Sequencing Primer
(F):5'- GCTTCTAGTCATCCAAGTAGGG -3'
(R):5'- CTTGCAGGTTCTAGATACATTGC -3'
Posted On 2020-01-23