Mutagenetix > Incidental Mutations

Incidental Mutation 'R8031:Eif4a3'

617967

Institutional Source

Beutler Lab

Gene Symbol

Eif4a3

Ensembl Gene

ENSMUSG00000025580

Gene Name

eukaryotic translation initiation factor 4A3

Synonyms

2400003O03Rik, Ddx48

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119288363-119300089 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119288905 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 352 (Y352C)

Ref Sequence

ENSEMBL: ENSMUSP00000026667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000026667] [ENSMUST00000106253] [ENSMUST00000106259]

AlphaFold

Q91VC3

Predicted Effect

probably benign
Transcript: ENSMUST00000026666

SMART Domains

Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PD	80	134	1.08e-15	SMART
Pfam:Gal_mutarotas_2	254	320	3.7e-12	PFAM
Pfam:Glyco_hydro_31	340	825	8.8e-175	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000026667
AA Change: Y352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026667
Gene: ENSMUSG00000025580
AA Change: Y352C

Domain	Start	End	E-Value	Type
DEXDc	57	254	2.44e-57	SMART
HELICc	291	372	1.63e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106253

SMART Domains

Protein: ENSMUSP00000101860
Gene: ENSMUSG00000025580

Domain	Start	End	E-Value	Type
DEXDc	57	233	2.28e-39	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106259

SMART Domains

Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PD	80	134	1.08e-15	SMART
Pfam:NtCtMGAM_N	147	253	3.5e-32	PFAM
Pfam:Gal_mutarotas_2	254	320	6.5e-12	PFAM
Pfam:Glyco_hydro_31	340	825	1.8e-153	PFAM

Meta Mutation Damage Score

0.9628

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a nuclear matrix protein. Its amino acid sequence is highly similar to the amino acid sequences of the translation initiation factors eIF4AI and eIF4AII, two other members of the DEAD box protein family. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Itga8	G	T	2: 12,155,486	D840E	probably benign	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Ntrk2	T	C	13: 58,874,379	I416T	probably benign	Het
Olfr1080	G	A	2: 86,554,103	T7I	probably damaging	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr177	T	C	16: 58,872,691	N153S	probably benign	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Psmd4	T	C	3: 95,035,892	D67G	probably damaging	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc25a25	A	T	2: 32,421,505	L118Q	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Sorbs1	C	A	19: 40,326,489	M626I	probably benign	Het
Spink5	T	A	18: 44,010,236	D753E	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Eif4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01307:Eif4a3	APN	11	119293561	missense	probably damaging	1.00
IGL03204:Eif4a3	APN	11	119293616	missense	possibly damaging	0.90
tagalong	UTSW	11	119288905	missense	probably damaging	1.00
R1916:Eif4a3	UTSW	11	119293911	missense	probably benign	0.00
R4969:Eif4a3	UTSW	11	119288879	missense	probably damaging	1.00
R5317:Eif4a3	UTSW	11	119294664	missense	probably damaging	0.99
R5588:Eif4a3	UTSW	11	119296126	missense	probably benign	0.34
R8886:Eif4a3	UTSW	11	119288879	missense	probably damaging	1.00
R8919:Eif4a3	UTSW	11	119299932	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCTGAGAATCCGGATGTCATC -3'
(R):5'- GTTTTCCATCATGGCAGCAGG -3'

Sequencing Primer
(F):5'- GAGAATCCGGATGTCATCATTCTTC -3'
(R):5'- CCATCATGGCAGCAGGTTTTG -3'

Posted On

2020-01-23