Incidental Mutation 'R0659:Golga5'
ID61797
Institutional Source Beutler Lab
Gene Symbol Golga5
Ensembl Gene ENSMUSG00000021192
Gene Namegolgi autoantigen, golgin subfamily a, 5
SynonymsRet-II
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0659 (G1)
Quality Score106
Status Validated
Chromosome12
Chromosomal Location102469135-102497907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102476208 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 269 (V269F)
Ref Sequence ENSEMBL: ENSMUSP00000137305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021609] [ENSMUST00000179218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021609
AA Change: V269F

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021609
Gene: ENSMUSG00000021192
AA Change: V269F

DomainStartEndE-ValueType
low complexity region 148 167 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
Pfam:Golgin_A5 233 709 1.1e-172 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179218
AA Change: V269F

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137305
Gene: ENSMUSG00000021192
AA Change: V269F

DomainStartEndE-ValueType
low complexity region 148 167 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
Pfam:Golgin_A5 233 709 1.1e-172 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein is a coiled-coil membrane protein that has been postulated to play a role in vesicle tethering and docking. Translocations involving this gene and the ret proto-oncogene have been found in tumor tissues; the chimeric sequences have been designated RET-II and PTC5. A pseudogene of this gene is located on the short arm of chromosome 5. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout does not result in an obvious phenotype and does not affect Golgi apparatus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Golga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Golga5 APN 12 102493814 missense probably damaging 0.99
IGL01487:Golga5 APN 12 102495696 intron probably benign
IGL01585:Golga5 APN 12 102479695 missense probably benign
IGL01901:Golga5 APN 12 102479802 critical splice donor site probably null
IGL02063:Golga5 APN 12 102472159 missense probably benign 0.00
IGL02118:Golga5 APN 12 102495752 missense possibly damaging 0.67
IGL02568:Golga5 APN 12 102472079 missense probably benign 0.33
FR4976:Golga5 UTSW 12 102475660 intron probably null
R0244:Golga5 UTSW 12 102476188 missense probably benign
R0432:Golga5 UTSW 12 102476208 missense possibly damaging 0.50
R0552:Golga5 UTSW 12 102484493 missense possibly damaging 0.75
R1244:Golga5 UTSW 12 102472295 missense probably benign 0.01
R1542:Golga5 UTSW 12 102474720 missense probably damaging 1.00
R1791:Golga5 UTSW 12 102492131 missense possibly damaging 0.48
R2310:Golga5 UTSW 12 102492161 missense probably damaging 0.99
R5110:Golga5 UTSW 12 102472077 missense probably benign 0.02
R5704:Golga5 UTSW 12 102489448 missense probably benign 0.00
R6228:Golga5 UTSW 12 102484481 missense probably benign 0.00
R6229:Golga5 UTSW 12 102484481 missense probably benign 0.00
R6241:Golga5 UTSW 12 102472473 missense probably damaging 0.96
R7236:Golga5 UTSW 12 102474775 critical splice donor site probably null
R7355:Golga5 UTSW 12 102472235 missense possibly damaging 0.83
R7404:Golga5 UTSW 12 102484519 missense probably damaging 0.97
R7493:Golga5 UTSW 12 102484576 critical splice donor site probably null
R8062:Golga5 UTSW 12 102484480 missense probably benign
Z1177:Golga5 UTSW 12 102472005 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGTTCCGTTGGGACAGTGAGAATAG -3'
(R):5'- TCGTCTTTCTGTATTAGCAGAGTTGCC -3'

Sequencing Primer
(F):5'- AGAGTATTTCCTGAAACCCTGTG -3'
(R):5'- ATTAGCAGAGTTGCCTACCG -3'
Posted On2013-07-30