Incidental Mutation 'R8031:Kcnk13'
ID 617970
Institutional Source Beutler Lab
Gene Symbol Kcnk13
Ensembl Gene ENSMUSG00000045404
Gene Name potassium channel, subfamily K, member 13
Synonyms LOC381712, F730021E22Rik, LOC380778
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 99964499-100062682 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99966179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 78 (Y78C)
Ref Sequence ENSEMBL: ENSMUSP00000051846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049788] [ENSMUST00000160413] [ENSMUST00000177549]
AlphaFold Q8R1P5
Predicted Effect probably damaging
Transcript: ENSMUST00000049788
AA Change: Y78C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051846
Gene: ENSMUSG00000045404
AA Change: Y78C

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 75 151 4.7e-18 PFAM
Pfam:Ion_trans_2 195 285 3.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160413
AA Change: Y78C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123916
Gene: ENSMUSG00000045404
AA Change: Y78C

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 74 151 6e-17 PFAM
Pfam:Ion_trans_2 195 285 7.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177549
AA Change: Y78C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136882
Gene: ENSMUSG00000045404
AA Change: Y78C

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 75 151 4.7e-18 PFAM
Pfam:Ion_trans_2 195 285 3.3e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a potassium channel containing two pore-forming domains. This protein is an open channel that can be stimulated by arachidonic acid and inhibited by the anesthetic halothane. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout reduces the surveillance activity of microglial cells in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Kcnk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Kcnk13 APN 12 100061662 missense probably benign 0.06
IGL01829:Kcnk13 APN 12 100060998 splice site probably benign
IGL01940:Kcnk13 APN 12 100061424 missense probably benign 0.01
IGL02549:Kcnk13 APN 12 100061751 nonsense probably null
IGL03105:Kcnk13 APN 12 100061110 missense probably damaging 1.00
R4730:Kcnk13 UTSW 12 100061715 missense probably damaging 0.98
R4851:Kcnk13 UTSW 12 99966124 missense probably damaging 0.98
R5284:Kcnk13 UTSW 12 100061289 missense probably benign 0.01
R5411:Kcnk13 UTSW 12 100061251 missense probably damaging 1.00
R6254:Kcnk13 UTSW 12 99965372 start gained probably benign
R6836:Kcnk13 UTSW 12 100061689 missense probably damaging 0.98
R6862:Kcnk13 UTSW 12 100061689 missense probably damaging 0.98
R6863:Kcnk13 UTSW 12 100061689 missense probably damaging 0.98
R6897:Kcnk13 UTSW 12 100061767 missense probably benign 0.11
R7211:Kcnk13 UTSW 12 100061817 missense probably damaging 0.96
R7438:Kcnk13 UTSW 12 100061726 missense probably damaging 0.99
R8813:Kcnk13 UTSW 12 100061388 missense probably damaging 1.00
Z1177:Kcnk13 UTSW 12 100061529 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAAGGTCGGCAGAGCACATC -3'
(R):5'- AAAGGAATCCCGAGGTGCATC -3'

Sequencing Primer
(F):5'- AGCTGTCCTCCAGTGCCATG -3'
(R):5'- CAAGCGGAGAACCCCAAGG -3'
Posted On 2020-01-23