Mutagenetix > Incidental Mutations

Incidental Mutation 'R8031:Ntrk2'

617973

Institutional Source

Beutler Lab

Gene Symbol

Ntrk2

Ensembl Gene

ENSMUSG00000055254

Gene Name

neurotrophic tyrosine kinase, receptor, type 2

Synonyms

C030027L06Rik, Tkrb, trkB

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58806569-59133970 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58874379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 416 (I416T)

Ref Sequence

ENSEMBL: ENSMUSP00000078757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000109838] [ENSMUST00000224259] [ENSMUST00000224402] [ENSMUST00000225488] [ENSMUST00000225583] [ENSMUST00000225950]

AlphaFold

P15209

Predicted Effect

probably benign
Transcript: ENSMUST00000079828
AA Change: I416T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: I416T

Domain	Start	End	E-Value	Type
LRRNT	31	65	1.74e-4	SMART
LRRCT	148	195	8.56e-10	SMART
IGc2	209	273	4.43e-5	SMART
Pfam:I-set	298	377	1.2e-8	PFAM
transmembrane domain	431	453	N/A	INTRINSIC
TyrKc	537	806	2.48e-142	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109838
AA Change: I416T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000105464
Gene: ENSMUSG00000055254
AA Change: I416T

Domain	Start	End	E-Value	Type
LRRNT	31	65	1.74e-4	SMART
LRRCT	148	195	8.56e-10	SMART
IGc2	209	273	4.43e-5	SMART
Pfam:I-set	298	377	1.1e-8	PFAM
Pfam:Ig_2	300	377	5.4e-4	PFAM
transmembrane domain	431	453	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224259
AA Change: I416T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000224402
AA Change: I416T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000225488
AA Change: I416T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000225583
AA Change: I416T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000225950
AA Change: I416T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Eif4a3	T	C	11: 119,288,905	Y352C	probably damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Itga8	G	T	2: 12,155,486	D840E	probably benign	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Olfr1080	G	A	2: 86,554,103	T7I	probably damaging	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr177	T	C	16: 58,872,691	N153S	probably benign	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Psmd4	T	C	3: 95,035,892	D67G	probably damaging	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc25a25	A	T	2: 32,421,505	L118Q	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Sorbs1	C	A	19: 40,326,489	M626I	probably benign	Het
Spink5	T	A	18: 44,010,236	D753E	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Ntrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01928:Ntrk2	APN	13	58846851	missense	probably damaging	1.00
IGL02331:Ntrk2	APN	13	58846856	critical splice donor site	probably null
IGL02465:Ntrk2	APN	13	59060380	missense	probably damaging	1.00
Brainy	UTSW	13	59126568	missense	probably damaging	1.00
PIT4366001:Ntrk2	UTSW	13	59060335	missense	probably damaging	1.00
R0102:Ntrk2	UTSW	13	58808793	missense	probably benign	0.00
R0547:Ntrk2	UTSW	13	58874370	missense	probably damaging	0.99
R0615:Ntrk2	UTSW	13	59128186	nonsense	probably null
R0620:Ntrk2	UTSW	13	58846821	missense	probably benign
R1770:Ntrk2	UTSW	13	58861318	missense	possibly damaging	0.67
R2063:Ntrk2	UTSW	13	58859297	missense	probably damaging	1.00
R2089:Ntrk2	UTSW	13	58859301	missense	possibly damaging	0.95
R2091:Ntrk2	UTSW	13	58859301	missense	possibly damaging	0.95
R2091:Ntrk2	UTSW	13	58859301	missense	possibly damaging	0.95
R2178:Ntrk2	UTSW	13	58808802	missense	probably benign	0.06
R2275:Ntrk2	UTSW	13	58861351	missense	probably damaging	1.00
R2370:Ntrk2	UTSW	13	59054434	missense	probably benign	0.28
R2413:Ntrk2	UTSW	13	58874412	missense	possibly damaging	0.56
R2520:Ntrk2	UTSW	13	59054276	splice site	probably null
R2926:Ntrk2	UTSW	13	59060284	missense	probably damaging	1.00
R4163:Ntrk2	UTSW	13	58860240	missense	probably damaging	1.00
R4320:Ntrk2	UTSW	13	58860146	missense	possibly damaging	0.48
R4348:Ntrk2	UTSW	13	58878259	missense	probably damaging	1.00
R4440:Ntrk2	UTSW	13	59060312	missense	probably damaging	1.00
R4534:Ntrk2	UTSW	13	59126529	missense	probably damaging	1.00
R4695:Ntrk2	UTSW	13	59126493	missense	probably damaging	0.99
R5356:Ntrk2	UTSW	13	59060242	missense	probably damaging	1.00
R5471:Ntrk2	UTSW	13	58871760	missense	probably benign	0.01
R5750:Ntrk2	UTSW	13	58808922	missense	probably benign	0.02
R5916:Ntrk2	UTSW	13	58808729	start codon destroyed	probably null	0.98
R5972:Ntrk2	UTSW	13	58837819	missense	probably damaging	1.00
R6015:Ntrk2	UTSW	13	59060395	missense	probably damaging	1.00
R6298:Ntrk2	UTSW	13	58871756	nonsense	probably null
R6419:Ntrk2	UTSW	13	58861299	nonsense	probably null
R6488:Ntrk2	UTSW	13	58861356	missense	possibly damaging	0.93
R6611:Ntrk2	UTSW	13	59054414	missense	probably damaging	1.00
R6827:Ntrk2	UTSW	13	59126568	missense	probably damaging	1.00
R6911:Ntrk2	UTSW	13	58859215	missense	probably damaging	1.00
R7387:Ntrk2	UTSW	13	58985979	missense	probably damaging	1.00
R7445:Ntrk2	UTSW	13	58846762	missense	probably benign	0.03
R7561:Ntrk2	UTSW	13	58861388	missense	probably benign	0.31
R8044:Ntrk2	UTSW	13	59126499	missense	probably damaging	1.00
R8422:Ntrk2	UTSW	13	58985901	missense	probably damaging	1.00
R8941:Ntrk2	UTSW	13	59060295	missense	probably damaging	1.00
R8990:Ntrk2	UTSW	13	58860174	nonsense	probably null
R9129:Ntrk2	UTSW	13	59128270	missense	probably benign	0.01
Z1176:Ntrk2	UTSW	13	58874333	missense	probably benign
Z1177:Ntrk2	UTSW	13	58859273	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGTCTGACAGTGATTCAG -3'
(R):5'- GGTTCCATGGTCTCTACATCAC -3'

Sequencing Primer
(F):5'- ACAGTGATTCAGATTCTCTGGGCC -3'
(R):5'- CTAGTAGAACCTCCGATCTGTGATG -3'

Posted On

2020-01-23