Incidental Mutation 'R0659:Itpk1'
ID61798
Institutional Source Beutler Lab
Gene Symbol Itpk1
Ensembl Gene ENSMUSG00000057963
Gene Nameinositol 1,3,4-triphosphate 5/6 kinase
Synonyms
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R0659 (G1)
Quality Score128
Status Validated
Chromosome12
Chromosomal Location102568582-102704930 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 102606078 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046518] [ENSMUST00000179210] [ENSMUST00000191320]
Predicted Effect probably benign
Transcript: ENSMUST00000046518
SMART Domains Protein: ENSMUSP00000046027
Gene: ENSMUSG00000057963

DomainStartEndE-ValueType
Pfam:Ins134_P3_kin 1 318 2.8e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179210
Predicted Effect probably benign
Transcript: ENSMUST00000191320
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the inositol 1,3,4-trisphosphate 5/6-kinase family. This enzyme regulates the synthesis of inositol tetraphosphate, and downstream products, inositol pentakisphosphate and inositol hexakisphosphate. Inositol metabolism plays a role in the development of the neural tube. Disruptions in this gene are thought to be associated with neural tube defects. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mice homozygous for a gene trap allele exhibit neural tube defects (exencephaly and spina bifida), growth retardation, kyphoscoliosis, and rib formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Itpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Itpk1 APN 12 102606103 missense probably damaging 1.00
IGL02247:Itpk1 APN 12 102623409 missense probably damaging 1.00
IGL02998:Itpk1 APN 12 102579139 missense probably damaging 1.00
ANU23:Itpk1 UTSW 12 102606103 missense probably damaging 1.00
R0432:Itpk1 UTSW 12 102606078 splice site probably benign
R0622:Itpk1 UTSW 12 102573980 missense probably damaging 1.00
R0835:Itpk1 UTSW 12 102675448 missense probably damaging 1.00
R1171:Itpk1 UTSW 12 102606119 missense probably damaging 1.00
R1812:Itpk1 UTSW 12 102574058 missense probably benign 0.01
R1968:Itpk1 UTSW 12 102675470 splice site probably null
R2277:Itpk1 UTSW 12 102570260 missense probably benign
R2926:Itpk1 UTSW 12 102579130 missense probably damaging 1.00
R4584:Itpk1 UTSW 12 102570157 missense possibly damaging 0.89
R4690:Itpk1 UTSW 12 102606175 missense probably damaging 0.96
R5050:Itpk1 UTSW 12 102704810 missense probably damaging 1.00
R5326:Itpk1 UTSW 12 102573966 missense possibly damaging 0.49
R5801:Itpk1 UTSW 12 102573945 missense probably damaging 1.00
R5945:Itpk1 UTSW 12 102588553 missense probably damaging 0.97
R7262:Itpk1 UTSW 12 102675453 missense possibly damaging 0.89
R7421:Itpk1 UTSW 12 102574065 missense possibly damaging 0.92
R7883:Itpk1 UTSW 12 102606175 missense probably benign 0.35
R8438:Itpk1 UTSW 12 102606159 start gained probably benign
X0058:Itpk1 UTSW 12 102574024 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCCAGAATAGCTCTCCTCAAAG -3'
(R):5'- AATGCCCTTGTCACAGCATAGCC -3'

Sequencing Primer
(F):5'- CAAAGCATCCTCTGGCTTATG -3'
(R):5'- GTCACAGCATAGCCCCCTC -3'
Posted On2013-07-30