Mutagenetix > Incidental Mutations

Incidental Mutation 'R8031:Olfr177'

617981

Institutional Source

Beutler Lab

Gene Symbol

Olfr177

Ensembl Gene

ENSMUSG00000063137

Gene Name

olfactory receptor 177

Synonyms

GA_x54KRFPKG5P-55091371-55090442, MOR184-7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58870955-58874768 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58872691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 153 (N153S)

Ref Sequence

ENSEMBL: ENSMUSP00000150269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]

AlphaFold

E9Q7W1

Predicted Effect

probably benign
Transcript: ENSMUST00000072853
AA Change: N153S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: N153S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.7e-53	PFAM
Pfam:7TM_GPCR_Srsx	35	254	8.3e-6	PFAM
Pfam:7tm_1	41	290	1.2e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217377
AA Change: N153S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Eif4a3	T	C	11: 119,288,905	Y352C	probably damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Itga8	G	T	2: 12,155,486	D840E	probably benign	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Ntrk2	T	C	13: 58,874,379	I416T	probably benign	Het
Olfr1080	G	A	2: 86,554,103	T7I	probably damaging	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Psmd4	T	C	3: 95,035,892	D67G	probably damaging	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc25a25	A	T	2: 32,421,505	L118Q	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Sorbs1	C	A	19: 40,326,489	M626I	probably benign	Het
Spink5	T	A	18: 44,010,236	D753E	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Olfr177

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02084:Olfr177	APN	16	58873036	missense	probably damaging	1.00
IGL02223:Olfr177	APN	16	58872694	missense	probably damaging	1.00
R0131:Olfr177	UTSW	16	58872906	missense	probably benign	0.01
R0131:Olfr177	UTSW	16	58872906	missense	probably benign	0.01
R0132:Olfr177	UTSW	16	58872906	missense	probably benign	0.01
R0245:Olfr177	UTSW	16	58872866	missense	probably benign	0.01
R0717:Olfr177	UTSW	16	58872770	missense	probably damaging	1.00
R0975:Olfr177	UTSW	16	58873150	splice site	probably null
R1037:Olfr177	UTSW	16	58872970	missense	probably damaging	1.00
R1256:Olfr177	UTSW	16	58872843	nonsense	probably null
R1278:Olfr177	UTSW	16	58872977	missense	probably damaging	1.00
R1538:Olfr177	UTSW	16	58872898	missense	probably damaging	1.00
R1992:Olfr177	UTSW	16	58872511	missense	probably benign	0.43
R2173:Olfr177	UTSW	16	58872619	missense	probably damaging	0.99
R2392:Olfr177	UTSW	16	58872434	missense	probably damaging	1.00
R5651:Olfr177	UTSW	16	58872484	missense	probably damaging	0.99
R5652:Olfr177	UTSW	16	58872484	missense	probably damaging	0.99
R5653:Olfr177	UTSW	16	58872484	missense	probably damaging	0.99
R8108:Olfr177	UTSW	16	58872236	missense	probably benign
R8531:Olfr177	UTSW	16	58872653	missense	probably damaging	1.00
R8833:Olfr177	UTSW	16	58872596	missense	probably damaging	0.99
R9150:Olfr177	UTSW	16	58872642	nonsense	probably null
R9318:Olfr177	UTSW	16	58872385	missense	probably damaging	1.00
R9389:Olfr177	UTSW	16	58872613	missense	probably damaging	1.00
V8831:Olfr177	UTSW	16	58873075	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TGCACAAGTAGATAAGGCTTTGC -3'
(R):5'- TTCTCTCTATGAGTGCATGGC -3'

Sequencing Primer
(F):5'- CAAGTAGATAAGGCTTTGCTTCTTCC -3'
(R):5'- GGCACAGTTCTATTTTCTCTGTCTTG -3'

Posted On

2020-01-23